Incidental Mutation 'R4295:Pigf'
ID323285
Institutional Source Beutler Lab
Gene Symbol Pigf
Ensembl Gene ENSMUSG00000024145
Gene Namephosphatidylinositol glycan anchor biosynthesis, class F
Synonyms
MMRRC Submission 041084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4295 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location86997256-87025406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87023756 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000024957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024957] [ENSMUST00000024959] [ENSMUST00000160269]
Predicted Effect probably benign
Transcript: ENSMUST00000024957
AA Change: I46T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024957
Gene: ENSMUSG00000024145
AA Change: I46T

DomainStartEndE-ValueType
Pfam:PIG-F 21 204 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024959
SMART Domains Protein: ENSMUSP00000024959
Gene: ENSMUSG00000024146

DomainStartEndE-ValueType
Pfam:Cript 11 101 2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160269
SMART Domains Protein: ENSMUSP00000124994
Gene: ENSMUSG00000024146

DomainStartEndE-ValueType
Pfam:Cript 20 109 2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160824
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor, a glycolipid containing three mannose molecules in its core backbone, is found on many blood cells where it serves to anchor proteins to the cell surface. The encoded protein and another GPI synthesis protein, PIGO, function in the transfer of ethanolaminephosphate to the third mannose in GPI. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,713 S164P probably benign Het
4933427D06Rik A G 6: 89,107,901 noncoding transcript Het
Aldh1l2 C T 10: 83,495,920 V674M possibly damaging Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Atr A G 9: 95,874,426 I870V probably benign Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cd200r4 T C 16: 44,832,876 V3A probably damaging Het
Celf2 T C 2: 6,604,064 N302S probably benign Het
Dnah17 A T 11: 118,118,772 I363N probably damaging Het
Fam98a A T 17: 75,541,347 M124K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Foxj3 G T 4: 119,626,297 G555* probably null Het
Gm4841 T C 18: 60,270,190 N277S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lamb2 A G 9: 108,486,211 D863G probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lcn11 G A 2: 25,778,099 A90T possibly damaging Het
Olfr1032 T C 2: 86,008,270 Y165H probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr460 T A 6: 40,572,156 F257I probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pcgf2 A T 11: 97,693,456 Y24* probably null Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Prdm10 A G 9: 31,316,294 E65G possibly damaging Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tjp1 T C 7: 65,323,150 D514G probably damaging Het
Ttll11 TCGCCGCCGCCGCCGCCGCCGC TCGCCGCCGCCGCCGCCGC 2: 35,979,552 probably benign Het
Unc13c A G 9: 73,734,504 S1236P probably damaging Het
Utp20 G T 10: 88,754,519 D2364E possibly damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn1r76 T C 7: 11,931,130 I52M probably benign Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfp451 A T 1: 33,777,755 F154L probably damaging Het
Other mutations in Pigf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pigf APN 17 87020448 missense probably null 0.41
IGL01484:Pigf APN 17 87008880 missense probably benign 0.04
R0506:Pigf UTSW 17 87008909 missense probably benign 0.00
R0684:Pigf UTSW 17 87020495 missense probably benign 0.31
R0987:Pigf UTSW 17 86997545 missense probably damaging 1.00
R5365:Pigf UTSW 17 87023708 missense possibly damaging 0.62
R6287:Pigf UTSW 17 86997539 missense probably damaging 1.00
R8420:Pigf UTSW 17 87020482 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAATCACTCAATAAGGACGAAGC -3'
(R):5'- AGAGTATTGAAGTGCTTGGGAC -3'

Sequencing Primer
(F):5'- AAGCGAAACTTCCTTCTTACACTG -3'
(R):5'- CTGACATCAAGAGACTTCTG -3'
Posted On2015-06-20