Mutagenetix > Incidental Mutations

Incidental Mutation 'R4296:Rab3gap2'

323291

Institutional Source

Beutler Lab

Gene Symbol

Rab3gap2

Ensembl Gene

ENSMUSG00000039318

Gene Name

RAB3 GTPase activating protein subunit 2

Synonyms

1110059F07Rik

MMRRC Submission

041656-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4296 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

185204117-185286759 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 185255837 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141608 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]

Predicted Effect

probably null
Transcript: ENSMUST00000069652

SMART Domains

Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-167	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	767	1366	3.2e-245	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000194740

SMART Domains

Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-157	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	766	1346	2.5e-233	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	G	T	19: 43,823,074	G993C	probably damaging	Het
Abcc2	G	C	19: 43,823,075	G993A	probably damaging	Het
Abi3bp	A	T	16: 56,668,310	H810L	probably benign	Het
Aldh1l2	T	C	10: 83,522,777	D5G	probably benign	Het
Aldh7a1	A	T	18: 56,544,963		probably null	Het
Aox1	T	A	1: 58,057,400		probably null	Het
Apbb1	G	T	7: 105,573,826	Q193K	probably benign	Het
Arl9	C	A	5: 77,006,549	N41K	probably damaging	Het
Armc1	A	G	3: 19,149,516	M82T	probably damaging	Het
Bms1	T	C	6: 118,404,999	E526G	probably damaging	Het
Cacna1a	C	T	8: 84,559,293	R809C	probably damaging	Het
Cd200r1	T	C	16: 44,789,670	I84T	probably damaging	Het
Cgrrf1	T	C	14: 46,832,355	V27A	probably damaging	Het
Clec4f	G	A	6: 83,652,575	Q334*	probably null	Het
Cpeb3	C	T	19: 37,173,989	G329D	possibly damaging	Het
Ctnnbl1	C	T	2: 157,819,570		probably null	Het
Dip2b	A	T	15: 100,181,336	M810L	probably benign	Het
Eml3	T	C	19: 8,931,409	S158P	probably damaging	Het
Eps8l2	G	T	7: 141,358,262	E470*	probably null	Het
Flt3l	A	G	7: 45,134,004	F146S	probably damaging	Het
Glmn	A	T	5: 107,558,502	V419E	possibly damaging	Het
Gm11360	T	A	13: 27,956,312	I53N	probably damaging	Het
Gpbp1l1	T	A	4: 116,587,459	V275D	possibly damaging	Het
Harbi1	T	A	2: 91,712,755	M187K	possibly damaging	Het
Has3	T	C	8: 106,878,422	V420A	possibly damaging	Het
Huwe1	C	A	X: 151,888,448	T1012K	probably benign	Het
Iqcg	G	A	16: 33,016,975		probably benign	Het
Itga4	G	A	2: 79,272,799	G111R	probably damaging	Het
Keap1	A	G	9: 21,233,986	S243P	probably damaging	Het
Kmt2a	C	T	9: 44,821,175		probably benign	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Ltbp3	A	T	19: 5,756,582		probably null	Het
Mbtps1	C	T	8: 119,522,499	C684Y	possibly damaging	Het
Mcm3ap	A	T	10: 76,507,337	I1688F	probably damaging	Het
Midn	C	T	10: 80,151,719	T21I	probably damaging	Het
Naf1	C	T	8: 66,889,462	P580S	possibly damaging	Het
Nlrp3	A	T	11: 59,549,661	E688V	possibly damaging	Het
Nusap1	A	G	2: 119,639,648	H259R	probably damaging	Het
Nxpe4	A	G	9: 48,398,984	T516A	probably damaging	Het
Oas1g	T	A	5: 120,879,167	T275S	probably damaging	Het
Ogdh	T	G	11: 6,349,374	F743V	probably damaging	Het
Olfr1109	T	C	2: 87,092,630	T256A	probably benign	Het
Olfr1505	A	G	19: 13,919,353	E111G	probably damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr790	C	A	10: 129,501,470	C195*	probably null	Het
Olfr811	C	A	10: 129,802,300	C75F	probably damaging	Het
Pdzd3	G	A	9: 44,248,861	R349C	probably benign	Het
Peg10	GGAT	GGATCCCCATCATGAT	6: 4,756,472		probably benign	Het
Piezo1	T	A	8: 122,491,127	Y819F	probably damaging	Het
Plekhg2	C	A	7: 28,371,166	G20C	probably damaging	Het
Polq	A	G	16: 37,061,301	T997A	possibly damaging	Het
Polr3a	T	A	14: 24,453,196	Q1190L	possibly damaging	Het
Ppp1r15a	T	A	7: 45,523,749	K800*	probably null	Het
Prkdc	T	A	16: 15,737,905	M2181K	probably damaging	Het
Pskh1	C	A	8: 105,912,904	A72E	probably benign	Het
Purg	T	C	8: 33,387,293	Y320H	probably damaging	Het
Rnps1	T	A	17: 24,425,115		probably benign	Het
Scgb2b21	A	T	7: 33,519,808	V57E	probably benign	Het
Sdhaf2	A	T	19: 10,525,075	I7N	probably benign	Het
Six4	A	G	12: 73,104,125	Y549H	probably damaging	Het
Slc4a10	G	T	2: 62,234,428	V209F	possibly damaging	Het
Slc4a11	C	A	2: 130,685,007	V734F	probably benign	Het
Stk4	T	A	2: 164,117,984	M27K	possibly damaging	Het
Tecrl	A	T	5: 83,313,327	C79*	probably null	Het
Tgm3	G	T	2: 130,038,413	V380L	possibly damaging	Het
Tiam2	A	T	17: 3,450,845	M920L	probably benign	Het
Tjp1	T	C	7: 65,318,489	N729S	probably damaging	Het
Tlr12	A	G	4: 128,617,788	L223P	probably damaging	Het
Tmem268	T	C	4: 63,565,768		probably null	Het
Tmpo	A	T	10: 91,162,956	I323K	possibly damaging	Het
Tmx4	T	C	2: 134,598,629	S302G	probably benign	Het
Trip11	C	A	12: 101,885,868	E361*	probably null	Het
Tspyl3	T	A	2: 153,225,156	N54I	possibly damaging	Het
Upp2	A	T	2: 58,778,009	Y220F	probably damaging	Het
Usp22	G	T	11: 61,161,464		probably null	Het
Vezt	ACTCCTCCT	ACTCCT	10: 93,973,931		probably benign	Het
Vmn1r235	G	T	17: 21,262,300	G296W	probably damaging	Het
Vmn1r89	T	C	7: 13,220,186	V94A	possibly damaging	Het
Zfp607a	A	T	7: 27,865,648	E80V	probably damaging	Het

Other mutations in Rab3gap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Rab3gap2	APN	1	185238870	missense	probably damaging	1.00
IGL01620:Rab3gap2	APN	1	185204326	missense	probably benign
IGL01977:Rab3gap2	APN	1	185267023	nonsense	probably null
IGL02183:Rab3gap2	APN	1	185271468	nonsense	probably null
IGL02229:Rab3gap2	APN	1	185259383	missense	possibly damaging	0.71
IGL02231:Rab3gap2	APN	1	185266898	splice site	probably benign
IGL02506:Rab3gap2	APN	1	185252024	splice site	probably benign
IGL02618:Rab3gap2	APN	1	185251741	missense	possibly damaging	0.79
IGL02643:Rab3gap2	APN	1	185267000	missense	possibly damaging	0.69
IGL03239:Rab3gap2	APN	1	185249894	missense	probably damaging	1.00
PIT4498001:Rab3gap2	UTSW	1	185281685	missense	probably damaging	1.00
R0173:Rab3gap2	UTSW	1	185249907	missense	possibly damaging	0.51
R0372:Rab3gap2	UTSW	1	185262694	missense	possibly damaging	0.93
R0492:Rab3gap2	UTSW	1	185252392	splice site	probably benign
R0510:Rab3gap2	UTSW	1	185260508	splice site	probably benign
R0708:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R0711:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R1135:Rab3gap2	UTSW	1	185275943	missense	possibly damaging	0.95
R1428:Rab3gap2	UTSW	1	185247904	missense	probably damaging	1.00
R1599:Rab3gap2	UTSW	1	185251026	missense	probably benign	0.07
R1758:Rab3gap2	UTSW	1	185283884	missense	probably benign	0.13
R1903:Rab3gap2	UTSW	1	185221902	missense	probably benign
R1929:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R1994:Rab3gap2	UTSW	1	185236024	missense	probably damaging	1.00
R2010:Rab3gap2	UTSW	1	185278281	missense	possibly damaging	0.57
R2102:Rab3gap2	UTSW	1	185282389	missense	probably benign	0.00
R2120:Rab3gap2	UTSW	1	185261367	missense	possibly damaging	0.95
R2219:Rab3gap2	UTSW	1	185275916	missense	probably damaging	0.99
R2259:Rab3gap2	UTSW	1	185221859	missense	probably damaging	1.00
R2270:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R2272:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R3083:Rab3gap2	UTSW	1	185204269	missense	probably benign	0.00
R3776:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R4050:Rab3gap2	UTSW	1	185272643	critical splice donor site	probably null
R4130:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R4176:Rab3gap2	UTSW	1	185246666	missense	probably damaging	0.99
R4416:Rab3gap2	UTSW	1	185282347	missense	probably benign	0.00
R4426:Rab3gap2	UTSW	1	185235342	missense	probably damaging	1.00
R4516:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4518:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4891:Rab3gap2	UTSW	1	185259366	missense	probably benign	0.00
R4913:Rab3gap2	UTSW	1	185262829	missense	probably benign	0.12
R4955:Rab3gap2	UTSW	1	185267155	intron	probably benign
R5411:Rab3gap2	UTSW	1	185277145	critical splice acceptor site	probably null
R5516:Rab3gap2	UTSW	1	185235487	missense	probably benign	0.02
R5670:Rab3gap2	UTSW	1	185221899	missense	probably benign
R5670:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R6380:Rab3gap2	UTSW	1	185235984	missense	probably damaging	1.00
R6533:Rab3gap2	UTSW	1	185232954	splice site	probably null
R6655:Rab3gap2	UTSW	1	185250011	missense	probably damaging	1.00
R6676:Rab3gap2	UTSW	1	185283410	missense	probably damaging	1.00
R6726:Rab3gap2	UTSW	1	185247865	missense	probably damaging	0.99
R6969:Rab3gap2	UTSW	1	185236012	missense	probably damaging	1.00
R7151:Rab3gap2	UTSW	1	185248053	missense	probably benign	0.00
R7168:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R7196:Rab3gap2	UTSW	1	185281667	missense	probably damaging	1.00
R7201:Rab3gap2	UTSW	1	185267191	missense	probably damaging	1.00
R7371:Rab3gap2	UTSW	1	185251068	missense	probably damaging	1.00
R7573:Rab3gap2	UTSW	1	185282382	missense	probably benign
R7779:Rab3gap2	UTSW	1	185259444	missense	probably damaging	0.98
R7913:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
R7922:Rab3gap2	UTSW	1	185249920	missense	probably benign	0.00
R8115:Rab3gap2	UTSW	1	185267250	missense	possibly damaging	0.90
R8203:Rab3gap2	UTSW	1	185267179	missense	probably damaging	1.00
R8242:Rab3gap2	UTSW	1	185221853	missense	probably benign
R8322:Rab3gap2	UTSW	1	185246680	missense	probably benign	0.42
R8360:Rab3gap2	UTSW	1	185267073	intron	probably benign
R8515:Rab3gap2	UTSW	1	185262820	missense	probably benign	0.15
Z1088:Rab3gap2	UTSW	1	185281677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATAGGCTCGGTCGCATTC -3'
(R):5'- ATGTTTAAAGCTCCCAACGTAAGG -3'

Sequencing Primer
(F):5'- GGTCGCATTCTACTCTAATGTAAC -3'
(R):5'- GGGTATAGAATAAGTACCCCAGTTC -3'

Posted On

2015-06-20