Incidental Mutation 'R4296:Nusap1'
ID323297
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Namenucleolar and spindle associated protein 1
Synonyms2610201A12Rik, NuSAP
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119618298-119651244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119639648 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 259 (H259R)
Ref Sequence ENSEMBL: ENSMUSP00000028771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
Predicted Effect probably damaging
Transcript: ENSMUST00000028771
AA Change: H259R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306
AA Change: H259R

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068225
AA Change: H292R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306
AA Change: H292R

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153036
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7600:Nusap1 UTSW 2 119627638 small deletion probably benign
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF005:Nusap1 UTSW 2 119627590 small insertion probably benign
RF005:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF035:Nusap1 UTSW 2 119627579 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF041:Nusap1 UTSW 2 119627607 nonsense probably null
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF045:Nusap1 UTSW 2 119627610 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627586 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGATCATTCGAGGCAGCTG -3'
(R):5'- GCATTTCTTCCACCAGGGTAAATG -3'

Sequencing Primer
(F):5'- GCTGCTGCCACCAAAGC -3'
(R):5'- ATCCTATTGTGGTTTTGCACTTGAC -3'
Posted On2015-06-20