Incidental Mutation 'R4296:Glmn'
ID323310
Institutional Source Beutler Lab
Gene Symbol Glmn
Ensembl Gene ENSMUSG00000029276
Gene Nameglomulin, FKBP associated protein
Synonyms9330160J16Rik, Fap48, Fap68
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107548967-107597888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107558502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 419 (V419E)
Ref Sequence ENSEMBL: ENSMUSP00000080766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078021
AA Change: V419E

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276
AA Change: V419E

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082121
AA Change: V419E

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276
AA Change: V419E

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphorylated protein that is a member of a Skp1-Cullin-F-box-like complex. The protein is essential for normal development of the vasculature and mutations in this gene have been associated with glomuvenous malformations, also called glomangiomas. Multiple splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete embryonic lethality during organogenesis associated with growth retardation, delayed neural tube closure, incomplete embryo turning, pericardial effusion, disorganized yolk sac vascular plexus and head mesenchyme hypocellularity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Glmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Glmn APN 5 107570139 missense possibly damaging 0.79
IGL00925:Glmn APN 5 107557327 missense probably damaging 1.00
IGL01092:Glmn APN 5 107578512 critical splice acceptor site probably null
IGL02503:Glmn APN 5 107562778 missense probably damaging 0.98
IGL02725:Glmn APN 5 107575289 missense possibly damaging 0.95
IGL03116:Glmn APN 5 107551083 missense probably damaging 1.00
mauna_kea UTSW 5 107593880 critical splice acceptor site probably null
R0078:Glmn UTSW 5 107557970 missense probably benign 0.31
R0115:Glmn UTSW 5 107560934 missense probably benign 0.00
R0481:Glmn UTSW 5 107560934 missense probably benign 0.00
R1895:Glmn UTSW 5 107570244 missense probably benign 0.34
R1954:Glmn UTSW 5 107572377 missense probably damaging 1.00
R2090:Glmn UTSW 5 107561928 missense probably damaging 1.00
R2132:Glmn UTSW 5 107578455 missense probably damaging 0.98
R3962:Glmn UTSW 5 107561045 intron probably benign
R4591:Glmn UTSW 5 107561051 critical splice donor site probably null
R4679:Glmn UTSW 5 107561075 missense probably damaging 1.00
R4992:Glmn UTSW 5 107557301 missense probably damaging 1.00
R5140:Glmn UTSW 5 107570200 missense probably damaging 0.99
R5215:Glmn UTSW 5 107561886 missense probably benign 0.03
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6116:Glmn UTSW 5 107557340 missense probably damaging 1.00
R6671:Glmn UTSW 5 107549414 missense probably benign 0.37
R7748:Glmn UTSW 5 107562244 critical splice donor site probably null
R7789:Glmn UTSW 5 107549075 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCAGGGGTGTCAGAGTCATGT -3'
(R):5'- AGACACAGTTGTACATAAAATTCACT -3'

Sequencing Primer
(F):5'- TACTGACATATGCCACGC -3'
(R):5'- GAGTTCAAGGCCAGTCTAGTCTAC -3'
Posted On2015-06-20