Incidental Mutation 'R4296:Vmn1r89'
ID323316
Institutional Source Beutler Lab
Gene Symbol Vmn1r89
Ensembl Gene ENSMUSG00000095629
Gene Namevomeronasal 1 receptor 89
SynonymsV1rj2
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13213020-13220657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13220186 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000154046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053008] [ENSMUST00000226717] [ENSMUST00000227176] [ENSMUST00000227239] [ENSMUST00000227276] [ENSMUST00000227319] [ENSMUST00000227390] [ENSMUST00000228587]
Predicted Effect probably benign
Transcript: ENSMUST00000053008
AA Change: V283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000096413
Gene: ENSMUSG00000095629
AA Change: V283A

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 1.9e-15 PFAM
Pfam:7tm_1 25 295 1.1e-6 PFAM
Pfam:V1R 36 301 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226717
AA Change: V283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000227176
AA Change: V283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000227239
AA Change: V283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227276
AA Change: V238A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227319
AA Change: V94A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227390
AA Change: V215A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000228587
AA Change: V283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228825
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Vmn1r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Vmn1r89 APN 7 13219505 missense probably benign 0.28
IGL02085:Vmn1r89 APN 7 13219538 missense probably damaging 0.96
IGL02694:Vmn1r89 APN 7 13220129 missense probably benign 0.12
IGL02709:Vmn1r89 APN 7 13220204 missense probably damaging 1.00
PIT4142001:Vmn1r89 UTSW 7 13219588 missense probably benign
R0765:Vmn1r89 UTSW 7 13219540 missense probably benign 0.03
R1396:Vmn1r89 UTSW 7 13220011 missense probably damaging 1.00
R2249:Vmn1r89 UTSW 7 13220260 missense possibly damaging 0.90
R4472:Vmn1r89 UTSW 7 13219872 missense probably benign 0.04
R5037:Vmn1r89 UTSW 7 13219387 missense possibly damaging 0.88
R5267:Vmn1r89 UTSW 7 13220213 missense probably damaging 1.00
R5352:Vmn1r89 UTSW 7 13219357 missense probably benign
R5455:Vmn1r89 UTSW 7 13220267 missense probably benign 0.01
R5595:Vmn1r89 UTSW 7 13219930 missense possibly damaging 0.93
R5643:Vmn1r89 UTSW 7 13220219 missense possibly damaging 0.94
R7493:Vmn1r89 UTSW 7 13219705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCTACAGACACTACAAGAGATCC -3'
(R):5'- TCAGGTATTCAAGGTCCACATTC -3'

Sequencing Primer
(F):5'- AGTAGAAGCCTTTCCTCCCAG -3'
(R):5'- GGTATTCAAGGTCCACATTCAAATTG -3'
Posted On2015-06-20