Incidental Mutation 'R0003:Nfat5'
ID32332
Institutional Source Beutler Lab
Gene Symbol Nfat5
Ensembl Gene ENSMUSG00000003847
Gene Namenuclear factor of activated T cells 5
SynonymsOREBP, nfatz, TonEBP, B130038B15Rik
MMRRC Submission 038299-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R0003 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location107293470-107379517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107339075 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 156 (R156W)
Ref Sequence ENSEMBL: ENSMUSP00000116094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000133026] [ENSMUST00000144100] [ENSMUST00000151114] [ENSMUST00000154474] [ENSMUST00000169453]
Predicted Effect probably damaging
Transcript: ENSMUST00000075922
AA Change: R156W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847
AA Change: R156W

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 7.8e-23 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077440
AA Change: R80W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847
AA Change: R80W

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:RHD 206 363 1.5e-22 PFAM
IPT 368 466 3.33e-15 SMART
low complexity region 571 577 N/A INTRINSIC
low complexity region 658 678 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 839 844 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
internal_repeat_2 927 1110 7.13e-8 PROSPERO
internal_repeat_1 935 1128 2.59e-11 PROSPERO
internal_repeat_2 1122 1324 7.13e-8 PROSPERO
internal_repeat_1 1207 1426 2.59e-11 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000125721
AA Change: R156W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847
AA Change: R156W

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 1e-22 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
internal_repeat_2 1003 1186 2.22e-8 PROSPERO
internal_repeat_1 1011 1204 5.31e-12 PROSPERO
internal_repeat_2 1198 1400 2.22e-8 PROSPERO
internal_repeat_1 1283 1502 5.31e-12 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126397
Predicted Effect probably benign
Transcript: ENSMUST00000133026
SMART Domains Protein: ENSMUSP00000116631
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148006
Predicted Effect probably damaging
Transcript: ENSMUST00000151114
AA Change: R174W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847
AA Change: R174W

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000154474
SMART Domains Protein: ENSMUSP00000115036
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169453
AA Change: R174W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847
AA Change: R174W

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Meta Mutation Damage Score 0.1392 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dock1 T C 7: 134,730,064 probably benign Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Igf1r T C 7: 68,165,242 V297A probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lama5 T G 2: 180,178,079 probably null Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Tpp2 T A 1: 43,960,139 S358T possibly damaging Het
Trim25 G T 11: 89,015,772 V437L probably benign Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr11 G T 7: 129,599,061 G79C probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Nfat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfat5 APN 8 107367514 missense probably damaging 1.00
IGL01145:Nfat5 APN 8 107367215 missense probably damaging 0.99
IGL01700:Nfat5 APN 8 107339130 missense probably damaging 0.99
IGL01721:Nfat5 APN 8 107344979 critical splice donor site probably null
IGL01796:Nfat5 APN 8 107367641 missense probably damaging 1.00
IGL01976:Nfat5 APN 8 107367559 missense probably damaging 1.00
IGL02063:Nfat5 APN 8 107361818 missense probably benign 0.03
IGL02150:Nfat5 APN 8 107367952 nonsense probably null
IGL02174:Nfat5 APN 8 107339051 missense probably damaging 1.00
IGL02224:Nfat5 APN 8 107344815 missense probably benign 0.00
IGL02226:Nfat5 APN 8 107351522 nonsense probably null
IGL02324:Nfat5 APN 8 107366176 splice site probably benign
IGL02724:Nfat5 APN 8 107358735 missense probably damaging 0.97
fettfeld UTSW 8 107347727 missense probably damaging 1.00
Grunefeld UTSW 8 107355508 unclassified probably null
Kleinfeld UTSW 8 107351438 missense probably damaging 1.00
H8562:Nfat5 UTSW 8 107339382 splice site probably benign
R0117:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0118:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0119:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0135:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0138:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0141:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0302:Nfat5 UTSW 8 107358701 missense probably damaging 1.00
R0420:Nfat5 UTSW 8 107367461 missense probably damaging 1.00
R0613:Nfat5 UTSW 8 107366295 missense possibly damaging 0.83
R0691:Nfat5 UTSW 8 107355605 missense probably damaging 1.00
R0743:Nfat5 UTSW 8 107368066 missense probably damaging 1.00
R1329:Nfat5 UTSW 8 107369027 missense probably benign 0.42
R1550:Nfat5 UTSW 8 107370573 missense probably damaging 0.99
R1590:Nfat5 UTSW 8 107293890 missense probably damaging 1.00
R1778:Nfat5 UTSW 8 107361789 missense probably damaging 1.00
R1827:Nfat5 UTSW 8 107367334 missense probably benign 0.00
R1918:Nfat5 UTSW 8 107366236 missense probably damaging 0.97
R2679:Nfat5 UTSW 8 107344914 missense probably damaging 1.00
R2850:Nfat5 UTSW 8 107293860 missense probably damaging 1.00
R3703:Nfat5 UTSW 8 107351421 splice site probably benign
R3966:Nfat5 UTSW 8 107367289 missense possibly damaging 0.47
R4301:Nfat5 UTSW 8 107355695 intron probably benign
R4596:Nfat5 UTSW 8 107351500 missense possibly damaging 0.93
R4602:Nfat5 UTSW 8 107367223 nonsense probably null
R4627:Nfat5 UTSW 8 107369276 missense probably damaging 1.00
R4917:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R4918:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R5089:Nfat5 UTSW 8 107351438 missense probably damaging 1.00
R5495:Nfat5 UTSW 8 107368447 missense probably benign 0.03
R5566:Nfat5 UTSW 8 107369135 missense possibly damaging 0.47
R5851:Nfat5 UTSW 8 107347727 missense probably damaging 1.00
R6012:Nfat5 UTSW 8 107367133 missense probably benign 0.09
R6018:Nfat5 UTSW 8 107355651 critical splice donor site probably null
R6364:Nfat5 UTSW 8 107368277 missense probably benign 0.00
R6404:Nfat5 UTSW 8 107370588 missense probably benign 0.01
R6466:Nfat5 UTSW 8 107355508 unclassified probably null
R7056:Nfat5 UTSW 8 107368106 missense probably damaging 1.00
R7105:Nfat5 UTSW 8 107369191 missense possibly damaging 0.88
R7128:Nfat5 UTSW 8 107358691 missense probably benign 0.10
R7214:Nfat5 UTSW 8 107293883 missense probably damaging 0.99
R7276:Nfat5 UTSW 8 107367099 missense probably benign 0.25
R7560:Nfat5 UTSW 8 107370589 missense probably benign 0.15
X0022:Nfat5 UTSW 8 107347756 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGACAGCAAGGCTATGCAAG -3'
(R):5'- TCCGTGGTAAGCTGAGAAAGCAC -3'

Sequencing Primer
(F):5'- AAGTGGAGAGCTGCTCCTC -3'
(R):5'- ATTAGATTCTTCACAATCTCGTCG -3'
Posted On2013-05-09