Incidental Mutation 'R4296:Pdzd3'
ID323333
Institutional Source Beutler Lab
Gene Symbol Pdzd3
Ensembl Gene ENSMUSG00000032105
Gene NamePDZ domain containing 3
Synonymssodium-phosphate cotransporter IIa C-terminal-associated protein 2, Pdzk2, NaPi-Cap2
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44247307-44251471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44248861 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 349 (R349C)
Ref Sequence ENSEMBL: ENSMUSP00000034618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000092426] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213891] [ENSMUST00000215554] [ENSMUST00000215711] [ENSMUST00000216632] [ENSMUST00000217221] [ENSMUST00000217510]
Predicted Effect probably benign
Transcript: ENSMUST00000034618
AA Change: R349C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105
AA Change: R349C

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034621
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092426
SMART Domains Protein: ENSMUSP00000090082
Gene: ENSMUSG00000070306

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
coiled coil region 26 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168499
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213186
Predicted Effect probably benign
Transcript: ENSMUST00000213891
Predicted Effect probably benign
Transcript: ENSMUST00000215554
Predicted Effect probably benign
Transcript: ENSMUST00000215711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216047
Predicted Effect probably benign
Transcript: ENSMUST00000216632
Predicted Effect probably benign
Transcript: ENSMUST00000217221
Predicted Effect probably benign
Transcript: ENSMUST00000217510
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Pdzd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Pdzd3 APN 9 44249636 missense possibly damaging 0.84
IGL01639:Pdzd3 APN 9 44248679 missense probably benign 0.41
IGL02210:Pdzd3 APN 9 44248317 missense probably benign
IGL02502:Pdzd3 APN 9 44249651 missense probably benign
IGL03082:Pdzd3 APN 9 44250786 missense possibly damaging 0.65
R0543:Pdzd3 UTSW 9 44248934 missense probably damaging 1.00
R1180:Pdzd3 UTSW 9 44249246 missense probably benign 0.38
R1919:Pdzd3 UTSW 9 44250303 missense possibly damaging 0.83
R4019:Pdzd3 UTSW 9 44250820 unclassified probably null
R4020:Pdzd3 UTSW 9 44250820 unclassified probably null
R4430:Pdzd3 UTSW 9 44249744 missense probably benign
R4433:Pdzd3 UTSW 9 44247988 makesense probably null
R4567:Pdzd3 UTSW 9 44249026 missense possibly damaging 0.90
R4942:Pdzd3 UTSW 9 44248618 nonsense probably null
R5436:Pdzd3 UTSW 9 44248355 missense possibly damaging 0.79
R6320:Pdzd3 UTSW 9 44248683 missense probably benign 0.00
R6688:Pdzd3 UTSW 9 44248230 critical splice donor site probably null
R7625:Pdzd3 UTSW 9 44250297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTGTGTCTTCAACCGG -3'
(R):5'- GCAGTGAAGATGTCTCTGTCCC -3'

Sequencing Primer
(F):5'- TTCAACCGGAAGATCCTTGG -3'
(R):5'- AAGATGTCTCTGTCCCAGGGC -3'
Posted On2015-06-20