Incidental Mutation 'R4296:Aldh1l2'
ID 323338
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 041656-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4296 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83358641 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: D118G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: D118G

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: D5G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,811,513 (GRCm39) G993C probably damaging Het
Abcc2 G C 19: 43,811,514 (GRCm39) G993A probably damaging Het
Abi3bp A T 16: 56,488,673 (GRCm39) H810L probably benign Het
Aldh7a1 A T 18: 56,678,035 (GRCm39) probably null Het
Aox1 T A 1: 58,096,559 (GRCm39) probably null Het
Apbb1 G T 7: 105,223,033 (GRCm39) Q193K probably benign Het
Arl9 C A 5: 77,154,396 (GRCm39) N41K probably damaging Het
Armc1 A G 3: 19,203,680 (GRCm39) M82T probably damaging Het
Bms1 T C 6: 118,381,960 (GRCm39) E526G probably damaging Het
Cacna1a C T 8: 85,285,922 (GRCm39) R809C probably damaging Het
Cd200r1 T C 16: 44,610,033 (GRCm39) I84T probably damaging Het
Cgrrf1 T C 14: 47,069,812 (GRCm39) V27A probably damaging Het
Clec4f G A 6: 83,629,557 (GRCm39) Q334* probably null Het
Cpeb3 C T 19: 37,151,389 (GRCm39) G329D possibly damaging Het
Ctnnbl1 C T 2: 157,661,490 (GRCm39) probably null Het
Dip2b A T 15: 100,079,217 (GRCm39) M810L probably benign Het
Eml3 T C 19: 8,908,773 (GRCm39) S158P probably damaging Het
Eps8l2 G T 7: 140,938,175 (GRCm39) E470* probably null Het
Flt3l A G 7: 44,783,428 (GRCm39) F146S probably damaging Het
Glmn A T 5: 107,706,368 (GRCm39) V419E possibly damaging Het
Gm11360 T A 13: 28,140,295 (GRCm39) I53N probably damaging Het
Gpbp1l1 T A 4: 116,444,656 (GRCm39) V275D possibly damaging Het
Harbi1 T A 2: 91,543,100 (GRCm39) M187K possibly damaging Het
Has3 T C 8: 107,605,054 (GRCm39) V420A possibly damaging Het
Huwe1 C A X: 150,671,444 (GRCm39) T1012K probably benign Het
Iqcg G A 16: 32,837,345 (GRCm39) probably benign Het
Itga4 G A 2: 79,103,143 (GRCm39) G111R probably damaging Het
Keap1 A G 9: 21,145,282 (GRCm39) S243P probably damaging Het
Kmt2a C T 9: 44,732,472 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,584,098 (GRCm39) N286S probably damaging Het
Ltbp3 A T 19: 5,806,610 (GRCm39) probably null Het
Mbtps1 C T 8: 120,249,238 (GRCm39) C684Y possibly damaging Het
Mcm3ap A T 10: 76,343,171 (GRCm39) I1688F probably damaging Het
Midn C T 10: 79,987,553 (GRCm39) T21I probably damaging Het
Naf1 C T 8: 67,342,114 (GRCm39) P580S possibly damaging Het
Nherf4 G A 9: 44,160,158 (GRCm39) R349C probably benign Het
Nlrp3 A T 11: 59,440,487 (GRCm39) E688V possibly damaging Het
Nusap1 A G 2: 119,470,129 (GRCm39) H259R probably damaging Het
Nxpe4 A G 9: 48,310,284 (GRCm39) T516A probably damaging Het
Oas1g T A 5: 121,017,230 (GRCm39) T275S probably damaging Het
Ogdh T G 11: 6,299,374 (GRCm39) F743V probably damaging Het
Or5aq6 T C 2: 86,922,974 (GRCm39) T256A probably benign Het
Or5h24 G A 16: 58,919,124 (GRCm39) T77I unknown Het
Or6c215 C A 10: 129,638,169 (GRCm39) C75F probably damaging Het
Or6c75 C A 10: 129,337,339 (GRCm39) C195* probably null Het
Or9i1b A G 19: 13,896,717 (GRCm39) E111G probably damaging Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 (GRCm39) probably benign Het
Piezo1 T A 8: 123,217,866 (GRCm39) Y819F probably damaging Het
Plekhg2 C A 7: 28,070,591 (GRCm39) G20C probably damaging Het
Polq A G 16: 36,881,663 (GRCm39) T997A possibly damaging Het
Polr3a T A 14: 24,503,264 (GRCm39) Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,173,173 (GRCm39) K800* probably null Het
Prkdc T A 16: 15,555,769 (GRCm39) M2181K probably damaging Het
Pskh1 C A 8: 106,639,536 (GRCm39) A72E probably benign Het
Purg T C 8: 33,877,321 (GRCm39) Y320H probably damaging Het
Rab3gap2 T A 1: 184,988,034 (GRCm39) probably null Het
Rnps1 T A 17: 24,644,089 (GRCm39) probably benign Het
Scgb2b21 A T 7: 33,219,233 (GRCm39) V57E probably benign Het
Sdhaf2 A T 19: 10,502,439 (GRCm39) I7N probably benign Het
Six4 A G 12: 73,150,899 (GRCm39) Y549H probably damaging Het
Slc4a10 G T 2: 62,064,772 (GRCm39) V209F possibly damaging Het
Slc4a11 C A 2: 130,526,927 (GRCm39) V734F probably benign Het
Stk4 T A 2: 163,959,904 (GRCm39) M27K possibly damaging Het
Tecrl A T 5: 83,461,174 (GRCm39) C79* probably null Het
Tgm3 G T 2: 129,880,333 (GRCm39) V380L possibly damaging Het
Tiam2 A T 17: 3,501,120 (GRCm39) M920L probably benign Het
Tjp1 T C 7: 64,968,237 (GRCm39) N729S probably damaging Het
Tlr12 A G 4: 128,511,581 (GRCm39) L223P probably damaging Het
Tmem268 T C 4: 63,484,005 (GRCm39) probably null Het
Tmpo A T 10: 90,998,818 (GRCm39) I323K possibly damaging Het
Tmx4 T C 2: 134,440,549 (GRCm39) S302G probably benign Het
Trip11 C A 12: 101,852,127 (GRCm39) E361* probably null Het
Tspyl3 T A 2: 153,067,076 (GRCm39) N54I possibly damaging Het
Upp2 A T 2: 58,668,021 (GRCm39) Y220F probably damaging Het
Usp22 G T 11: 61,052,290 (GRCm39) probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,809,793 (GRCm39) probably benign Het
Vmn1r235 G T 17: 21,482,562 (GRCm39) G296W probably damaging Het
Vmn1r89 T C 7: 12,954,113 (GRCm39) V94A possibly damaging Het
Zfp607a A T 7: 27,565,073 (GRCm39) E80V probably damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACACCTCGTTTCTGTATC -3'
(R):5'- GCCTGTAAAAGTTGTGTGAAATTGC -3'

Sequencing Primer
(F):5'- CACCTCGTTTCTGTATCATGTAGAAG -3'
(R):5'- CCATGTGTTAATATGAGACCATGG -3'
Posted On 2015-06-20