Mutagenetix > Incidental Mutation

Incidental Mutation 'R4296:Aldh1l2'

323338

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

041656-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4296 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83522777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 5 (D5G)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably benign
Transcript: ENSMUST00000020497
AA Change: D118G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: D118G

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

probably benign
Transcript: ENSMUST00000146640
AA Change: D5G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: D5G

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	G	T	19: 43,823,074	G993C	probably damaging	Het
Abcc2	G	C	19: 43,823,075	G993A	probably damaging	Het
Abi3bp	A	T	16: 56,668,310	H810L	probably benign	Het
Aldh7a1	A	T	18: 56,544,963		probably null	Het
Aox1	T	A	1: 58,057,400		probably null	Het
Apbb1	G	T	7: 105,573,826	Q193K	probably benign	Het
Arl9	C	A	5: 77,006,549	N41K	probably damaging	Het
Armc1	A	G	3: 19,149,516	M82T	probably damaging	Het
Bms1	T	C	6: 118,404,999	E526G	probably damaging	Het
Cacna1a	C	T	8: 84,559,293	R809C	probably damaging	Het
Cd200r1	T	C	16: 44,789,670	I84T	probably damaging	Het
Cgrrf1	T	C	14: 46,832,355	V27A	probably damaging	Het
Clec4f	G	A	6: 83,652,575	Q334*	probably null	Het
Cpeb3	C	T	19: 37,173,989	G329D	possibly damaging	Het
Ctnnbl1	C	T	2: 157,819,570		probably null	Het
Dip2b	A	T	15: 100,181,336	M810L	probably benign	Het
Eml3	T	C	19: 8,931,409	S158P	probably damaging	Het
Eps8l2	G	T	7: 141,358,262	E470*	probably null	Het
Flt3l	A	G	7: 45,134,004	F146S	probably damaging	Het
Glmn	A	T	5: 107,558,502	V419E	possibly damaging	Het
Gm11360	T	A	13: 27,956,312	I53N	probably damaging	Het
Gpbp1l1	T	A	4: 116,587,459	V275D	possibly damaging	Het
Harbi1	T	A	2: 91,712,755	M187K	possibly damaging	Het
Has3	T	C	8: 106,878,422	V420A	possibly damaging	Het
Huwe1	C	A	X: 151,888,448	T1012K	probably benign	Het
Iqcg	G	A	16: 33,016,975		probably benign	Het
Itga4	G	A	2: 79,272,799	G111R	probably damaging	Het
Keap1	A	G	9: 21,233,986	S243P	probably damaging	Het
Kmt2a	C	T	9: 44,821,175		probably benign	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Ltbp3	A	T	19: 5,756,582		probably null	Het
Mbtps1	C	T	8: 119,522,499	C684Y	possibly damaging	Het
Mcm3ap	A	T	10: 76,507,337	I1688F	probably damaging	Het
Midn	C	T	10: 80,151,719	T21I	probably damaging	Het
Naf1	C	T	8: 66,889,462	P580S	possibly damaging	Het
Nlrp3	A	T	11: 59,549,661	E688V	possibly damaging	Het
Nusap1	A	G	2: 119,639,648	H259R	probably damaging	Het
Nxpe4	A	G	9: 48,398,984	T516A	probably damaging	Het
Oas1g	T	A	5: 120,879,167	T275S	probably damaging	Het
Ogdh	T	G	11: 6,349,374	F743V	probably damaging	Het
Olfr1109	T	C	2: 87,092,630	T256A	probably benign	Het
Olfr1505	A	G	19: 13,919,353	E111G	probably damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr790	C	A	10: 129,501,470	C195*	probably null	Het
Olfr811	C	A	10: 129,802,300	C75F	probably damaging	Het
Pdzd3	G	A	9: 44,248,861	R349C	probably benign	Het
Peg10	GGAT	GGATCCCCATCATGAT	6: 4,756,472		probably benign	Het
Piezo1	T	A	8: 122,491,127	Y819F	probably damaging	Het
Plekhg2	C	A	7: 28,371,166	G20C	probably damaging	Het
Polq	A	G	16: 37,061,301	T997A	possibly damaging	Het
Polr3a	T	A	14: 24,453,196	Q1190L	possibly damaging	Het
Ppp1r15a	T	A	7: 45,523,749	K800*	probably null	Het
Prkdc	T	A	16: 15,737,905	M2181K	probably damaging	Het
Pskh1	C	A	8: 105,912,904	A72E	probably benign	Het
Purg	T	C	8: 33,387,293	Y320H	probably damaging	Het
Rab3gap2	T	A	1: 185,255,837		probably null	Het
Rnps1	T	A	17: 24,425,115		probably benign	Het
Scgb2b21	A	T	7: 33,519,808	V57E	probably benign	Het
Sdhaf2	A	T	19: 10,525,075	I7N	probably benign	Het
Six4	A	G	12: 73,104,125	Y549H	probably damaging	Het
Slc4a10	G	T	2: 62,234,428	V209F	possibly damaging	Het
Slc4a11	C	A	2: 130,685,007	V734F	probably benign	Het
Stk4	T	A	2: 164,117,984	M27K	possibly damaging	Het
Tecrl	A	T	5: 83,313,327	C79*	probably null	Het
Tgm3	G	T	2: 130,038,413	V380L	possibly damaging	Het
Tiam2	A	T	17: 3,450,845	M920L	probably benign	Het
Tjp1	T	C	7: 65,318,489	N729S	probably damaging	Het
Tlr12	A	G	4: 128,617,788	L223P	probably damaging	Het
Tmem268	T	C	4: 63,565,768		probably null	Het
Tmpo	A	T	10: 91,162,956	I323K	possibly damaging	Het
Tmx4	T	C	2: 134,598,629	S302G	probably benign	Het
Trip11	C	A	12: 101,885,868	E361*	probably null	Het
Tspyl3	T	A	2: 153,225,156	N54I	possibly damaging	Het
Upp2	A	T	2: 58,778,009	Y220F	probably damaging	Het
Usp22	G	T	11: 61,161,464		probably null	Het
Vezt	ACTCCTCCT	ACTCCT	10: 93,973,931		probably benign	Het
Vmn1r235	G	T	17: 21,262,300	G296W	probably damaging	Het
Vmn1r89	T	C	7: 13,220,186	V94A	possibly damaging	Het
Zfp607a	A	T	7: 27,865,648	E80V	probably damaging	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCACACCTCGTTTCTGTATC -3'
(R):5'- GCCTGTAAAAGTTGTGTGAAATTGC -3'

Sequencing Primer
(F):5'- CACCTCGTTTCTGTATCATGTAGAAG -3'
(R):5'- CCATGTGTTAATATGAGACCATGG -3'

Posted On

2015-06-20