Mutagenetix > Incidental Mutations

Incidental Mutation 'R4296:Trip11'

323348

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

041656-MU

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4296 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 101885868 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 361 (E361*)

Ref Sequence

ENSEMBL: ENSMUSP00000134976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

Predicted Effect

probably null
Transcript: ENSMUST00000021605
AA Change: E646*

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: E646*

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000177183
AA Change: E361*

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: E361*

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	G	T	19: 43,823,074	G993C	probably damaging	Het
Abcc2	G	C	19: 43,823,075	G993A	probably damaging	Het
Abi3bp	A	T	16: 56,668,310	H810L	probably benign	Het
Aldh1l2	T	C	10: 83,522,777	D5G	probably benign	Het
Aldh7a1	A	T	18: 56,544,963		probably null	Het
Aox1	T	A	1: 58,057,400		probably null	Het
Apbb1	G	T	7: 105,573,826	Q193K	probably benign	Het
Arl9	C	A	5: 77,006,549	N41K	probably damaging	Het
Armc1	A	G	3: 19,149,516	M82T	probably damaging	Het
Bms1	T	C	6: 118,404,999	E526G	probably damaging	Het
Cacna1a	C	T	8: 84,559,293	R809C	probably damaging	Het
Cd200r1	T	C	16: 44,789,670	I84T	probably damaging	Het
Cgrrf1	T	C	14: 46,832,355	V27A	probably damaging	Het
Clec4f	G	A	6: 83,652,575	Q334*	probably null	Het
Cpeb3	C	T	19: 37,173,989	G329D	possibly damaging	Het
Ctnnbl1	C	T	2: 157,819,570		probably null	Het
Dip2b	A	T	15: 100,181,336	M810L	probably benign	Het
Eml3	T	C	19: 8,931,409	S158P	probably damaging	Het
Eps8l2	G	T	7: 141,358,262	E470*	probably null	Het
Flt3l	A	G	7: 45,134,004	F146S	probably damaging	Het
Glmn	A	T	5: 107,558,502	V419E	possibly damaging	Het
Gm11360	T	A	13: 27,956,312	I53N	probably damaging	Het
Gpbp1l1	T	A	4: 116,587,459	V275D	possibly damaging	Het
Harbi1	T	A	2: 91,712,755	M187K	possibly damaging	Het
Has3	T	C	8: 106,878,422	V420A	possibly damaging	Het
Huwe1	C	A	X: 151,888,448	T1012K	probably benign	Het
Iqcg	G	A	16: 33,016,975		probably benign	Het
Itga4	G	A	2: 79,272,799	G111R	probably damaging	Het
Keap1	A	G	9: 21,233,986	S243P	probably damaging	Het
Kmt2a	C	T	9: 44,821,175		probably benign	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Ltbp3	A	T	19: 5,756,582		probably null	Het
Mbtps1	C	T	8: 119,522,499	C684Y	possibly damaging	Het
Mcm3ap	A	T	10: 76,507,337	I1688F	probably damaging	Het
Midn	C	T	10: 80,151,719	T21I	probably damaging	Het
Naf1	C	T	8: 66,889,462	P580S	possibly damaging	Het
Nlrp3	A	T	11: 59,549,661	E688V	possibly damaging	Het
Nusap1	A	G	2: 119,639,648	H259R	probably damaging	Het
Nxpe4	A	G	9: 48,398,984	T516A	probably damaging	Het
Oas1g	T	A	5: 120,879,167	T275S	probably damaging	Het
Ogdh	T	G	11: 6,349,374	F743V	probably damaging	Het
Olfr1109	T	C	2: 87,092,630	T256A	probably benign	Het
Olfr1505	A	G	19: 13,919,353	E111G	probably damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr790	C	A	10: 129,501,470	C195*	probably null	Het
Olfr811	C	A	10: 129,802,300	C75F	probably damaging	Het
Pdzd3	G	A	9: 44,248,861	R349C	probably benign	Het
Peg10	GGAT	GGATCCCCATCATGAT	6: 4,756,472		probably benign	Het
Piezo1	T	A	8: 122,491,127	Y819F	probably damaging	Het
Plekhg2	C	A	7: 28,371,166	G20C	probably damaging	Het
Polq	A	G	16: 37,061,301	T997A	possibly damaging	Het
Polr3a	T	A	14: 24,453,196	Q1190L	possibly damaging	Het
Ppp1r15a	T	A	7: 45,523,749	K800*	probably null	Het
Prkdc	T	A	16: 15,737,905	M2181K	probably damaging	Het
Pskh1	C	A	8: 105,912,904	A72E	probably benign	Het
Purg	T	C	8: 33,387,293	Y320H	probably damaging	Het
Rab3gap2	T	A	1: 185,255,837		probably null	Het
Rnps1	T	A	17: 24,425,115		probably benign	Het
Scgb2b21	A	T	7: 33,519,808	V57E	probably benign	Het
Sdhaf2	A	T	19: 10,525,075	I7N	probably benign	Het
Six4	A	G	12: 73,104,125	Y549H	probably damaging	Het
Slc4a10	G	T	2: 62,234,428	V209F	possibly damaging	Het
Slc4a11	C	A	2: 130,685,007	V734F	probably benign	Het
Stk4	T	A	2: 164,117,984	M27K	possibly damaging	Het
Tecrl	A	T	5: 83,313,327	C79*	probably null	Het
Tgm3	G	T	2: 130,038,413	V380L	possibly damaging	Het
Tiam2	A	T	17: 3,450,845	M920L	probably benign	Het
Tjp1	T	C	7: 65,318,489	N729S	probably damaging	Het
Tlr12	A	G	4: 128,617,788	L223P	probably damaging	Het
Tmem268	T	C	4: 63,565,768		probably null	Het
Tmpo	A	T	10: 91,162,956	I323K	possibly damaging	Het
Tmx4	T	C	2: 134,598,629	S302G	probably benign	Het
Tspyl3	T	A	2: 153,225,156	N54I	possibly damaging	Het
Upp2	A	T	2: 58,778,009	Y220F	probably damaging	Het
Usp22	G	T	11: 61,161,464		probably null	Het
Vezt	ACTCCTCCT	ACTCCT	10: 93,973,931		probably benign	Het
Vmn1r235	G	T	17: 21,262,300	G296W	probably damaging	Het
Vmn1r89	T	C	7: 13,220,186	V94A	possibly damaging	Het
Zfp607a	A	T	7: 27,865,648	E80V	probably damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	unclassified	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0573:Trip11	UTSW	12	101886860	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5890:Trip11	UTSW	12	101885972	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101889742	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101884070	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101886974	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101844855	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101883537	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R7927:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGAAATCTGCTTGTTGCCAGC -3'
(R):5'- ACAGGCCCTAAGTGATTTACAG -3'

Sequencing Primer
(F):5'- TGCCAGCAACAGATTCTTCC -3'
(R):5'- GGCCCTAAGTGATTTACAGTTAACC -3'

Posted On

2015-06-20