Incidental Mutation 'R4296:Lrrk2'
ID 323353
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 041656-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock # R4296 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91699895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 286 (N286S)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably damaging
Transcript: ENSMUST00000060642
AA Change: N286S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: N286S

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Meta Mutation Damage Score 0.2414 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91702270 nonsense probably null
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
R9267:Lrrk2 UTSW 15 91700426 missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91778483 missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91723204 missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91752185 nonsense probably null
R9489:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91723162 missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91749840 missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91752185 nonsense probably null
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTCTCTTGCATTTAATGTACACCAC -3'
(R):5'- TCACACGAACAGGGAGATGC -3'

Sequencing Primer
(F):5'- CACCACTATGTTGTAAAGAGCG -3'
(R):5'- AAGAGCATCTTTCCGACTGG -3'
Posted On 2015-06-20