Incidental Mutation 'R4296:Dip2b'
ID 323354
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 041656-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R4296 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100079217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 810 (M810L)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: M576L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: M576L

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: M810L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: M810L

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: M576L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: M576L

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,811,513 (GRCm39) G993C probably damaging Het
Abcc2 G C 19: 43,811,514 (GRCm39) G993A probably damaging Het
Abi3bp A T 16: 56,488,673 (GRCm39) H810L probably benign Het
Aldh1l2 T C 10: 83,358,641 (GRCm39) D5G probably benign Het
Aldh7a1 A T 18: 56,678,035 (GRCm39) probably null Het
Aox1 T A 1: 58,096,559 (GRCm39) probably null Het
Apbb1 G T 7: 105,223,033 (GRCm39) Q193K probably benign Het
Arl9 C A 5: 77,154,396 (GRCm39) N41K probably damaging Het
Armc1 A G 3: 19,203,680 (GRCm39) M82T probably damaging Het
Bms1 T C 6: 118,381,960 (GRCm39) E526G probably damaging Het
Cacna1a C T 8: 85,285,922 (GRCm39) R809C probably damaging Het
Cd200r1 T C 16: 44,610,033 (GRCm39) I84T probably damaging Het
Cgrrf1 T C 14: 47,069,812 (GRCm39) V27A probably damaging Het
Clec4f G A 6: 83,629,557 (GRCm39) Q334* probably null Het
Cpeb3 C T 19: 37,151,389 (GRCm39) G329D possibly damaging Het
Ctnnbl1 C T 2: 157,661,490 (GRCm39) probably null Het
Eml3 T C 19: 8,908,773 (GRCm39) S158P probably damaging Het
Eps8l2 G T 7: 140,938,175 (GRCm39) E470* probably null Het
Flt3l A G 7: 44,783,428 (GRCm39) F146S probably damaging Het
Glmn A T 5: 107,706,368 (GRCm39) V419E possibly damaging Het
Gm11360 T A 13: 28,140,295 (GRCm39) I53N probably damaging Het
Gpbp1l1 T A 4: 116,444,656 (GRCm39) V275D possibly damaging Het
Harbi1 T A 2: 91,543,100 (GRCm39) M187K possibly damaging Het
Has3 T C 8: 107,605,054 (GRCm39) V420A possibly damaging Het
Huwe1 C A X: 150,671,444 (GRCm39) T1012K probably benign Het
Iqcg G A 16: 32,837,345 (GRCm39) probably benign Het
Itga4 G A 2: 79,103,143 (GRCm39) G111R probably damaging Het
Keap1 A G 9: 21,145,282 (GRCm39) S243P probably damaging Het
Kmt2a C T 9: 44,732,472 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,584,098 (GRCm39) N286S probably damaging Het
Ltbp3 A T 19: 5,806,610 (GRCm39) probably null Het
Mbtps1 C T 8: 120,249,238 (GRCm39) C684Y possibly damaging Het
Mcm3ap A T 10: 76,343,171 (GRCm39) I1688F probably damaging Het
Midn C T 10: 79,987,553 (GRCm39) T21I probably damaging Het
Naf1 C T 8: 67,342,114 (GRCm39) P580S possibly damaging Het
Nherf4 G A 9: 44,160,158 (GRCm39) R349C probably benign Het
Nlrp3 A T 11: 59,440,487 (GRCm39) E688V possibly damaging Het
Nusap1 A G 2: 119,470,129 (GRCm39) H259R probably damaging Het
Nxpe4 A G 9: 48,310,284 (GRCm39) T516A probably damaging Het
Oas1g T A 5: 121,017,230 (GRCm39) T275S probably damaging Het
Ogdh T G 11: 6,299,374 (GRCm39) F743V probably damaging Het
Or5aq6 T C 2: 86,922,974 (GRCm39) T256A probably benign Het
Or5h24 G A 16: 58,919,124 (GRCm39) T77I unknown Het
Or6c215 C A 10: 129,638,169 (GRCm39) C75F probably damaging Het
Or6c75 C A 10: 129,337,339 (GRCm39) C195* probably null Het
Or9i1b A G 19: 13,896,717 (GRCm39) E111G probably damaging Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 (GRCm39) probably benign Het
Piezo1 T A 8: 123,217,866 (GRCm39) Y819F probably damaging Het
Plekhg2 C A 7: 28,070,591 (GRCm39) G20C probably damaging Het
Polq A G 16: 36,881,663 (GRCm39) T997A possibly damaging Het
Polr3a T A 14: 24,503,264 (GRCm39) Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,173,173 (GRCm39) K800* probably null Het
Prkdc T A 16: 15,555,769 (GRCm39) M2181K probably damaging Het
Pskh1 C A 8: 106,639,536 (GRCm39) A72E probably benign Het
Purg T C 8: 33,877,321 (GRCm39) Y320H probably damaging Het
Rab3gap2 T A 1: 184,988,034 (GRCm39) probably null Het
Rnps1 T A 17: 24,644,089 (GRCm39) probably benign Het
Scgb2b21 A T 7: 33,219,233 (GRCm39) V57E probably benign Het
Sdhaf2 A T 19: 10,502,439 (GRCm39) I7N probably benign Het
Six4 A G 12: 73,150,899 (GRCm39) Y549H probably damaging Het
Slc4a10 G T 2: 62,064,772 (GRCm39) V209F possibly damaging Het
Slc4a11 C A 2: 130,526,927 (GRCm39) V734F probably benign Het
Stk4 T A 2: 163,959,904 (GRCm39) M27K possibly damaging Het
Tecrl A T 5: 83,461,174 (GRCm39) C79* probably null Het
Tgm3 G T 2: 129,880,333 (GRCm39) V380L possibly damaging Het
Tiam2 A T 17: 3,501,120 (GRCm39) M920L probably benign Het
Tjp1 T C 7: 64,968,237 (GRCm39) N729S probably damaging Het
Tlr12 A G 4: 128,511,581 (GRCm39) L223P probably damaging Het
Tmem268 T C 4: 63,484,005 (GRCm39) probably null Het
Tmpo A T 10: 90,998,818 (GRCm39) I323K possibly damaging Het
Tmx4 T C 2: 134,440,549 (GRCm39) S302G probably benign Het
Trip11 C A 12: 101,852,127 (GRCm39) E361* probably null Het
Tspyl3 T A 2: 153,067,076 (GRCm39) N54I possibly damaging Het
Upp2 A T 2: 58,668,021 (GRCm39) Y220F probably damaging Het
Usp22 G T 11: 61,052,290 (GRCm39) probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,809,793 (GRCm39) probably benign Het
Vmn1r235 G T 17: 21,482,562 (GRCm39) G296W probably damaging Het
Vmn1r89 T C 7: 12,954,113 (GRCm39) V94A possibly damaging Het
Zfp607a A T 7: 27,565,073 (GRCm39) E80V probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGTGTACATGTTTCACAGG -3'
(R):5'- ATTTCATGCCTCAGCTGCAG -3'

Sequencing Primer
(F):5'- ACATGTTTCACAGGTACGTTTC -3'
(R):5'- GCTTTGTCACTCTAAGCTAGACCAG -3'
Posted On 2015-06-20