Incidental Mutation 'R4296:Huwe1'
ID323372
Institutional Source Beutler Lab
Gene Symbol Huwe1
Ensembl Gene ENSMUSG00000025261
Gene NameHECT, UBA and WWE domain containing 1
SynonymsLOC382250, C430014N20Rik, Ib772, Ureb1, Mule, Arf-bp1, 5430439H10Rik
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4296 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location151800807-151935417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 151888448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1012 (T1012K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026292] [ENSMUST00000112622]
Predicted Effect probably benign
Transcript: ENSMUST00000026292
AA Change: T1509K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026292
Gene: ENSMUSG00000025261
AA Change: T1509K

DomainStartEndE-ValueType
Pfam:DUF908 90 369 4.2e-38 PFAM
Pfam:DUF913 430 814 6.1e-121 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1614 1679 3.5e-16 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2021 2036 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
low complexity region 2131 2143 N/A INTRINSIC
low complexity region 2262 2272 N/A INTRINSIC
low complexity region 2276 2293 N/A INTRINSIC
low complexity region 2348 2358 N/A INTRINSIC
low complexity region 2409 2471 N/A INTRINSIC
low complexity region 2527 2543 N/A INTRINSIC
low complexity region 2591 2601 N/A INTRINSIC
low complexity region 2679 2702 N/A INTRINSIC
low complexity region 2739 2759 N/A INTRINSIC
low complexity region 2766 2781 N/A INTRINSIC
low complexity region 2914 2933 N/A INTRINSIC
low complexity region 2945 2960 N/A INTRINSIC
Pfam:DUF4414 2969 3080 1.3e-32 PFAM
low complexity region 3091 3108 N/A INTRINSIC
low complexity region 3173 3182 N/A INTRINSIC
low complexity region 3224 3239 N/A INTRINSIC
low complexity region 3254 3264 N/A INTRINSIC
low complexity region 3370 3384 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3476 3553 N/A INTRINSIC
low complexity region 3750 3762 N/A INTRINSIC
coiled coil region 3763 3787 N/A INTRINSIC
low complexity region 3838 3860 N/A INTRINSIC
low complexity region 3919 3935 N/A INTRINSIC
HECTc 4040 4378 2.28e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112622
AA Change: T1509K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108241
Gene: ENSMUSG00000025261
AA Change: T1509K

DomainStartEndE-ValueType
Pfam:DUF908 89 370 1.8e-74 PFAM
Pfam:DUF913 429 815 1.2e-126 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1611 1679 3.5e-14 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2130 2142 N/A INTRINSIC
low complexity region 2261 2271 N/A INTRINSIC
low complexity region 2275 2292 N/A INTRINSIC
low complexity region 2347 2357 N/A INTRINSIC
low complexity region 2408 2470 N/A INTRINSIC
low complexity region 2526 2542 N/A INTRINSIC
low complexity region 2590 2600 N/A INTRINSIC
low complexity region 2678 2701 N/A INTRINSIC
low complexity region 2738 2758 N/A INTRINSIC
low complexity region 2765 2780 N/A INTRINSIC
low complexity region 2913 2932 N/A INTRINSIC
low complexity region 2944 2959 N/A INTRINSIC
Pfam:DUF4414 2968 3079 1.1e-34 PFAM
low complexity region 3090 3107 N/A INTRINSIC
low complexity region 3172 3181 N/A INTRINSIC
low complexity region 3223 3238 N/A INTRINSIC
low complexity region 3253 3263 N/A INTRINSIC
low complexity region 3369 3383 N/A INTRINSIC
low complexity region 3445 3460 N/A INTRINSIC
low complexity region 3475 3552 N/A INTRINSIC
low complexity region 3749 3761 N/A INTRINSIC
coiled coil region 3762 3786 N/A INTRINSIC
low complexity region 3837 3859 N/A INTRINSIC
low complexity region 3918 3934 N/A INTRINSIC
HECTc 4039 4377 2.28e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138023
AA Change: T1012K

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120057
Gene: ENSMUSG00000025261
AA Change: T1012K

DomainStartEndE-ValueType
Pfam:DUF913 2 318 7.3e-110 PFAM
low complexity region 345 362 N/A INTRINSIC
low complexity region 391 405 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 587 608 N/A INTRINSIC
low complexity region 796 818 N/A INTRINSIC
UBA 822 858 1.3e-4 SMART
low complexity region 901 928 N/A INTRINSIC
low complexity region 1030 1046 N/A INTRINSIC
Pfam:WWE 1118 1176 7.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C-terminal HECT (E6AP type E3 ubiquitin protein ligase) domain that functions as an E3 ubiquitin ligase. The encoded protein is required for the ubiquitination and subsequent degradation of the anti-apoptotic protein Mcl1 (myeloid cell leukemia sequence 1 (BCL2-related)). This protein also ubiquitinates the p53 tumor suppressor, core histones, and DNA polymerase beta. Mutations in this gene are associated with Turner type X-linked syndromic mental retardation. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons results in neonatal lethality, poorly developed dentate gyrus, small cerebellum, increased cortex density, and increased neuronal precursor cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Huwe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Huwe1 APN X 151885627 missense probably damaging 1.00
IGL00707:Huwe1 APN X 151860734 missense probably damaging 1.00
IGL00932:Huwe1 APN X 151860161 splice site probably benign
IGL01413:Huwe1 APN X 151882680 missense possibly damaging 0.48
IGL01685:Huwe1 APN X 151898670 splice site probably benign
IGL02120:Huwe1 APN X 151907390 missense possibly damaging 0.53
IGL02176:Huwe1 APN X 151903968 missense possibly damaging 0.47
IGL02868:Huwe1 APN X 151908833 missense possibly damaging 0.91
IGL02902:Huwe1 APN X 151886766 missense probably damaging 0.98
IGL02971:Huwe1 APN X 151927626 splice site probably benign
R0650:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0651:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0657:Huwe1 UTSW X 151919928 missense probably benign 0.33
R1241:Huwe1 UTSW X 151907048 small deletion probably benign
R1247:Huwe1 UTSW X 151901570 missense probably benign 0.03
R1791:Huwe1 UTSW X 151864753 missense probably benign 0.06
R4561:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4562:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4563:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R5339:Huwe1 UTSW X 151907048 small deletion probably benign
Z1176:Huwe1 UTSW X 151856575
Z1176:Huwe1 UTSW X 151928381
Predicted Primers PCR Primer
(F):5'- CTGCAAATATATTGAGGTTGGAGGG -3'
(R):5'- GACAGAAACTGACCATCATCTTTTG -3'

Sequencing Primer
(F):5'- TCACAGACTGGGTTACTC -3'
(R):5'- TTGGTACACATGAAATACAAGGACC -3'
Posted On2015-06-20