Mutagenetix > Incidental Mutations

Incidental Mutation 'R4297:Alkbh3'

323380

Institutional Source

Beutler Lab

Gene Symbol

Alkbh3

Ensembl Gene

ENSMUSG00000040174

Gene Name

alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase

Synonyms

mABH3, 1700108H04Rik, 1810020C19Rik, Abh3

MMRRC Submission

041085-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.221) question?

Stock #

R4297 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93980550-94010807 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 94008124 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 34 (R34H)

Ref Sequence

ENSEMBL: ENSMUSP00000122043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040005] [ENSMUST00000111240] [ENSMUST00000126378]

Predicted Effect

probably benign
Transcript: ENSMUST00000040005
AA Change: R33H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038721
Gene: ENSMUSG00000040174
AA Change: R33H

Domain	Start	End	E-Value	Type
Pfam:2OG-FeII_Oxy_2	89	275	2e-34	PFAM
Pfam:2OG-FeII_Oxy	172	277	2.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111240
AA Change: R34H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106871
Gene: ENSMUSG00000040174
AA Change: R34H

Domain	Start	End	E-Value	Type
Pfam:2OG-FeII_Oxy_2	90	276	3.6e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126378
AA Change: R34H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122043
Gene: ENSMUSG00000040174
AA Change: R34H

Domain	Start	End	E-Value	Type
Pfam:2OG-FeII_Oxy_2	90	202	8.9e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127231

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130289

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138046

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156763

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

85% (33/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal lifespan and are phenotypically indistinguishable from control littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Cacna1e	T	G	1: 154,398,731	S2143R	probably benign	Het
Camkk2	A	G	5: 122,745,706		probably null	Het
Cep295	A	G	9: 15,322,654	V2282A	probably benign	Het
Cfap46	A	C	7: 139,652,673	D827E	probably benign	Het
Col5a1	T	C	2: 28,017,204		probably null	Het
Col6a3	T	A	1: 90,811,378	E376V	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp2a4	A	G	7: 26,307,368	T51A	probably damaging	Het
Dgke	A	T	11: 89,050,730	V273D	probably damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Fpr-rs3	A	T	17: 20,624,746	N44K	probably damaging	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gm6818	A	T	7: 38,402,453		noncoding transcript	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Gsto2	A	C	19: 47,876,496	E156A	possibly damaging	Het
Hbb-bs	T	C	7: 103,826,744	D122G	probably benign	Het
Mc5r	T	C	18: 68,339,307	F246L	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slc6a21	G	A	7: 45,287,762	V239M	possibly damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Ttn	C	A	2: 76,726,263	G30133C	probably damaging	Het
Ugt1a8	T	C	1: 88,088,104	S80P	probably benign	Het
Vax1	G	T	19: 59,166,251	S318*	probably null	Het
Vcam1	A	T	3: 116,117,243	V502E	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Vps18	T	A	2: 119,297,331	C878*	probably null	Het
Wdr11	A	G	7: 129,625,186	R791G	probably benign	Het

Other mutations in Alkbh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Alkbh3	APN	2	94003051	critical splice donor site	probably null
IGL01940:Alkbh3	APN	2	93981595	missense	probably damaging	0.98
IGL02554:Alkbh3	APN	2	93996347	missense	probably damaging	1.00
IGL02638:Alkbh3	APN	2	94008113	missense	probably benign	0.02
IGL02640:Alkbh3	APN	2	93996361	missense	possibly damaging	0.90
R0409:Alkbh3	UTSW	2	94001448	missense	possibly damaging	0.84
R0437:Alkbh3	UTSW	2	93981569	missense	probably damaging	1.00
R1456:Alkbh3	UTSW	2	94001419	splice site	probably null
R1592:Alkbh3	UTSW	2	94008424	intron	probably null
R2359:Alkbh3	UTSW	2	94008113	missense	probably benign	0.01
R3109:Alkbh3	UTSW	2	94004763	missense	probably damaging	1.00
R5562:Alkbh3	UTSW	2	93996379	unclassified	probably null
R6216:Alkbh3	UTSW	2	94008536	start gained	probably benign
R7088:Alkbh3	UTSW	2	94004752	missense	possibly damaging	0.55
R7711:Alkbh3	UTSW	2	94008092	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATCCTTTGTTCTGCTACTCACAAG -3'
(R):5'- GTGACTGCCATTTTGTCTGC -3'

Sequencing Primer
(F):5'- GCTACTCACAAGTAAATGTATTCAGC -3'
(R):5'- CTGCTCTGTGGATGGTGAACTAAG -3'

Posted On

2015-06-20