Incidental Mutation 'R4297:Reln'
ID 323383
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 041085-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R4297 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 21884454-22344702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21920487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 2733 (C2733G)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: C2733G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: C2733G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159768
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: C2733G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: C2733G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.8547 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 (GRCm38) probably null Het
Alkbh3 C T 2: 94,008,124 (GRCm38) R34H probably benign Het
Cacna1e T G 1: 154,398,731 (GRCm38) S2143R probably benign Het
Camkk2 A G 5: 122,745,706 (GRCm38) probably null Het
Cep295 A G 9: 15,322,654 (GRCm38) V2282A probably benign Het
Cfap46 A C 7: 139,652,673 (GRCm38) D827E probably benign Het
Col5a1 T C 2: 28,017,204 (GRCm38) probably null Het
Col6a3 T A 1: 90,811,378 (GRCm38) E376V probably damaging Het
Creld2 T C 15: 88,823,753 (GRCm38) C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 (GRCm38) V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 (GRCm38) T51A probably damaging Het
Dgke A T 11: 89,050,730 (GRCm38) V273D probably damaging Het
Epcam T C 17: 87,640,534 (GRCm38) probably null Het
Fpr-rs3 A T 17: 20,624,746 (GRCm38) N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 (GRCm38) D119V probably benign Het
Gm6818 A T 7: 38,402,453 (GRCm38) noncoding transcript Het
Gprc5b G A 7: 118,984,214 (GRCm38) A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 (GRCm38) E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 (GRCm38) D122G probably benign Het
Mc5r T C 18: 68,339,307 (GRCm38) F246L probably benign Het
Ncapd3 A G 9: 27,052,327 (GRCm38) N492S probably benign Het
Setx GTGGCT GT 2: 29,154,061 (GRCm38) 1814 probably null Het
Slc6a21 G A 7: 45,287,762 (GRCm38) V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 (GRCm38) M177T probably benign Het
Ttn C A 2: 76,726,263 (GRCm38) G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 (GRCm38) S80P probably benign Het
Vax1 G T 19: 59,166,251 (GRCm38) S318* probably null Het
Vcam1 A T 3: 116,117,243 (GRCm38) V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 (GRCm38) M244I probably benign Het
Vps18 T A 2: 119,297,331 (GRCm38) C878* probably null Het
Wdr11 A G 7: 129,625,186 (GRCm38) R791G probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,010,127 (GRCm38) missense probably damaging 1.00
IGL00433:Reln APN 5 22,045,009 (GRCm38) missense probably damaging 1.00
IGL00576:Reln APN 5 22,154,950 (GRCm38) missense probably benign 0.01
IGL00755:Reln APN 5 22,060,380 (GRCm38) missense probably damaging 0.98
IGL00777:Reln APN 5 22,018,850 (GRCm38) critical splice donor site probably null
IGL00900:Reln APN 5 21,980,117 (GRCm38) missense probably damaging 0.98
IGL01067:Reln APN 5 21,979,666 (GRCm38) missense probably damaging 1.00
IGL01104:Reln APN 5 21,986,967 (GRCm38) missense probably damaging 0.99
IGL01141:Reln APN 5 21,969,033 (GRCm38) missense probably damaging 1.00
IGL01141:Reln APN 5 21,919,069 (GRCm38) missense probably damaging 1.00
IGL01333:Reln APN 5 22,171,251 (GRCm38) missense probably damaging 0.99
IGL01341:Reln APN 5 21,969,079 (GRCm38) missense probably damaging 1.00
IGL01354:Reln APN 5 21,919,175 (GRCm38) nonsense probably null
IGL01361:Reln APN 5 21,919,021 (GRCm38) missense probably benign 0.06
IGL01446:Reln APN 5 21,969,317 (GRCm38) missense probably damaging 0.99
IGL01448:Reln APN 5 22,040,405 (GRCm38) missense probably benign 0.40
IGL01612:Reln APN 5 21,896,930 (GRCm38) missense probably damaging 0.99
IGL01695:Reln APN 5 21,920,438 (GRCm38) missense probably damaging 1.00
IGL01718:Reln APN 5 21,947,514 (GRCm38) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,344,246 (GRCm38) nonsense probably null
IGL01875:Reln APN 5 21,904,717 (GRCm38) missense probably benign
IGL02013:Reln APN 5 21,950,879 (GRCm38) missense probably damaging 1.00
IGL02031:Reln APN 5 21,979,016 (GRCm38) missense probably damaging 0.99
IGL02186:Reln APN 5 21,909,958 (GRCm38) missense probably damaging 1.00
IGL02228:Reln APN 5 21,904,731 (GRCm38) missense probably damaging 0.99
IGL02248:Reln APN 5 21,910,992 (GRCm38) missense probably damaging 1.00
IGL02336:Reln APN 5 21,929,134 (GRCm38) missense probably damaging 1.00
IGL02352:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,080,791 (GRCm38) nonsense probably null
IGL02408:Reln APN 5 21,901,619 (GRCm38) missense probably benign 0.44
IGL02415:Reln APN 5 21,971,951 (GRCm38) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,040,427 (GRCm38) missense probably benign 0.00
IGL02540:Reln APN 5 22,034,752 (GRCm38) missense probably damaging 0.96
IGL02624:Reln APN 5 22,103,357 (GRCm38) missense probably benign 0.09
IGL02720:Reln APN 5 21,997,941 (GRCm38) missense probably damaging 0.99
IGL02894:Reln APN 5 21,885,548 (GRCm38) missense possibly damaging 0.72
IGL02999:Reln APN 5 21,995,365 (GRCm38) missense probably damaging 1.00
IGL03125:Reln APN 5 21,910,844 (GRCm38) missense probably damaging 1.00
IGL03298:Reln APN 5 21,910,836 (GRCm38) missense probably damaging 0.99
Fishing UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
P0020:Reln UTSW 5 22,106,060 (GRCm38) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R0018:Reln UTSW 5 21,925,371 (GRCm38) missense probably benign 0.01
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0127:Reln UTSW 5 22,004,136 (GRCm38) missense probably damaging 1.00
R0135:Reln UTSW 5 22,128,649 (GRCm38) missense probably damaging 0.99
R0144:Reln UTSW 5 21,948,449 (GRCm38) missense probably damaging 0.97
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0266:Reln UTSW 5 21,988,776 (GRCm38) missense probably damaging 1.00
R0269:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0280:Reln UTSW 5 22,227,513 (GRCm38) splice site probably benign
R0333:Reln UTSW 5 21,929,242 (GRCm38) missense probably damaging 0.97
R0357:Reln UTSW 5 21,950,822 (GRCm38) missense probably damaging 1.00
R0359:Reln UTSW 5 22,048,800 (GRCm38) missense probably damaging 0.98
R0506:Reln UTSW 5 21,920,496 (GRCm38) missense probably damaging 0.97
R0534:Reln UTSW 5 21,947,408 (GRCm38) missense probably damaging 0.99
R0535:Reln UTSW 5 22,051,276 (GRCm38) splice site probably benign
R0541:Reln UTSW 5 21,980,109 (GRCm38) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,010,150 (GRCm38) missense probably benign 0.36
R0617:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0634:Reln UTSW 5 22,018,869 (GRCm38) missense probably damaging 1.00
R0653:Reln UTSW 5 21,913,230 (GRCm38) missense probably benign 0.44
R0704:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0706:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0959:Reln UTSW 5 22,227,628 (GRCm38) missense probably damaging 0.96
R1066:Reln UTSW 5 22,034,664 (GRCm38) missense probably damaging 1.00
R1110:Reln UTSW 5 22,034,775 (GRCm38) missense probably benign
R1163:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R1222:Reln UTSW 5 21,986,955 (GRCm38) missense probably null 0.97
R1226:Reln UTSW 5 21,910,866 (GRCm38) missense probably damaging 1.00
R1440:Reln UTSW 5 22,128,602 (GRCm38) splice site probably benign
R1532:Reln UTSW 5 22,034,744 (GRCm38) missense probably damaging 0.99
R1552:Reln UTSW 5 21,960,378 (GRCm38) missense probably benign 0.01
R1565:Reln UTSW 5 21,925,213 (GRCm38) missense probably benign 0.05
R1618:Reln UTSW 5 22,060,368 (GRCm38) missense probably benign 0.01
R1636:Reln UTSW 5 21,998,683 (GRCm38) missense probably damaging 0.99
R1664:Reln UTSW 5 21,929,086 (GRCm38) missense probably damaging 1.00
R1716:Reln UTSW 5 21,955,095 (GRCm38) missense probably damaging 0.98
R1759:Reln UTSW 5 22,010,289 (GRCm38) missense probably damaging 0.99
R1835:Reln UTSW 5 21,979,002 (GRCm38) missense probably damaging 1.00
R1907:Reln UTSW 5 22,044,962 (GRCm38) critical splice donor site probably null
R1991:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2046:Reln UTSW 5 21,942,627 (GRCm38) missense probably benign 0.01
R2072:Reln UTSW 5 21,919,177 (GRCm38) missense probably damaging 1.00
R2103:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,019,000 (GRCm38) missense probably damaging 1.00
R2120:Reln UTSW 5 21,969,085 (GRCm38) missense probably damaging 1.00
R2216:Reln UTSW 5 22,048,005 (GRCm38) missense probably benign 0.30
R2219:Reln UTSW 5 21,972,047 (GRCm38) missense possibly damaging 0.88
R2228:Reln UTSW 5 21,987,078 (GRCm38) missense possibly damaging 0.69
R2306:Reln UTSW 5 21,896,786 (GRCm38) missense probably damaging 1.00
R2316:Reln UTSW 5 22,154,956 (GRCm38) missense probably benign 0.00
R2321:Reln UTSW 5 21,915,020 (GRCm38) missense probably damaging 0.99
R2512:Reln UTSW 5 21,979,690 (GRCm38) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,344,369 (GRCm38) missense unknown
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,040,420 (GRCm38) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3706:Reln UTSW 5 21,995,589 (GRCm38) splice site probably benign
R3713:Reln UTSW 5 21,904,734 (GRCm38) missense probably damaging 0.99
R3770:Reln UTSW 5 21,948,566 (GRCm38) missense probably damaging 1.00
R3836:Reln UTSW 5 21,911,014 (GRCm38) missense probably damaging 1.00
R3887:Reln UTSW 5 21,910,849 (GRCm38) missense possibly damaging 0.92
R3972:Reln UTSW 5 21,979,001 (GRCm38) missense probably damaging 0.99
R3975:Reln UTSW 5 21,995,366 (GRCm38) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,227,630 (GRCm38) missense probably benign 0.45
R4044:Reln UTSW 5 22,128,632 (GRCm38) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,034,584 (GRCm38) missense probably damaging 1.00
R4298:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4299:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4518:Reln UTSW 5 21,901,743 (GRCm38) missense probably benign 0.44
R4615:Reln UTSW 5 21,972,872 (GRCm38) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,152,463 (GRCm38) missense probably benign 0.17
R4720:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R4721:Reln UTSW 5 21,919,222 (GRCm38) missense probably damaging 0.99
R4771:Reln UTSW 5 22,049,700 (GRCm38) missense probably damaging 1.00
R4794:Reln UTSW 5 22,344,185 (GRCm38) missense probably damaging 0.98
R4840:Reln UTSW 5 22,018,846 (GRCm38) splice site probably null
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4896:Reln UTSW 5 21,955,238 (GRCm38) missense probably damaging 1.00
R4908:Reln UTSW 5 21,979,720 (GRCm38) missense probably benign 0.02
R4912:Reln UTSW 5 21,925,193 (GRCm38) missense probably benign 0.29
R4922:Reln UTSW 5 21,995,587 (GRCm38) critical splice acceptor site probably null
R4975:Reln UTSW 5 21,960,426 (GRCm38) missense probably damaging 1.00
R4976:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5020:Reln UTSW 5 22,034,638 (GRCm38) missense probably damaging 1.00
R5037:Reln UTSW 5 21,948,512 (GRCm38) missense probably damaging 1.00
R5082:Reln UTSW 5 21,896,077 (GRCm38) missense probably benign 0.00
R5119:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5125:Reln UTSW 5 21,913,241 (GRCm38) missense possibly damaging 0.78
R5137:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R5152:Reln UTSW 5 21,948,629 (GRCm38) missense probably damaging 1.00
R5154:Reln UTSW 5 21,988,765 (GRCm38) missense probably damaging 0.99
R5259:Reln UTSW 5 22,103,397 (GRCm38) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,011,163 (GRCm38) missense probably damaging 1.00
R5386:Reln UTSW 5 22,039,529 (GRCm38) missense probably benign
R5400:Reln UTSW 5 21,979,714 (GRCm38) missense probably damaging 1.00
R5478:Reln UTSW 5 22,004,203 (GRCm38) missense probably benign 0.00
R5514:Reln UTSW 5 21,971,885 (GRCm38) missense possibly damaging 0.93
R5529:Reln UTSW 5 21,932,715 (GRCm38) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,039,665 (GRCm38) nonsense probably null
R5648:Reln UTSW 5 21,998,572 (GRCm38) missense probably benign 0.04
R5649:Reln UTSW 5 21,901,625 (GRCm38) missense probably benign 0.33
R5744:Reln UTSW 5 22,106,083 (GRCm38) missense probably null 0.39
R5782:Reln UTSW 5 22,018,056 (GRCm38) missense probably benign 0.01
R5815:Reln UTSW 5 21,947,433 (GRCm38) missense probably damaging 0.99
R5838:Reln UTSW 5 21,899,113 (GRCm38) missense probably damaging 0.97
R6162:Reln UTSW 5 21,911,050 (GRCm38) missense probably damaging 1.00
R6219:Reln UTSW 5 21,948,596 (GRCm38) missense probably damaging 1.00
R6259:Reln UTSW 5 22,060,333 (GRCm38) missense probably damaging 0.99
R6279:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6299:Reln UTSW 5 22,286,944 (GRCm38) missense possibly damaging 0.71
R6300:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6314:Reln UTSW 5 22,152,484 (GRCm38) nonsense probably null
R6351:Reln UTSW 5 21,901,663 (GRCm38) nonsense probably null
R6369:Reln UTSW 5 22,051,361 (GRCm38) missense probably benign 0.03
R6371:Reln UTSW 5 21,995,513 (GRCm38) missense probably benign
R6374:Reln UTSW 5 22,080,714 (GRCm38) missense probably benign 0.06
R6425:Reln UTSW 5 21,911,020 (GRCm38) nonsense probably null
R6442:Reln UTSW 5 21,932,776 (GRCm38) missense probably benign
R6445:Reln UTSW 5 21,919,214 (GRCm38) missense probably benign 0.05
R6554:Reln UTSW 5 21,896,840 (GRCm38) missense probably damaging 1.00
R6641:Reln UTSW 5 21,929,134 (GRCm38) missense probably damaging 1.00
R6768:Reln UTSW 5 21,978,907 (GRCm38) missense probably damaging 0.99
R6859:Reln UTSW 5 22,034,570 (GRCm38) missense probably damaging 1.00
R6896:Reln UTSW 5 21,899,179 (GRCm38) missense probably benign 0.18
R6932:Reln UTSW 5 21,985,857 (GRCm38) missense probably benign 0.00
R6948:Reln UTSW 5 21,972,035 (GRCm38) missense probably damaging 1.00
R6959:Reln UTSW 5 21,976,564 (GRCm38) missense probably damaging 1.00
R7085:Reln UTSW 5 21,915,087 (GRCm38) nonsense probably null
R7091:Reln UTSW 5 21,899,029 (GRCm38) missense probably null 0.08
R7135:Reln UTSW 5 21,976,596 (GRCm38) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,106,097 (GRCm38) missense probably damaging 0.97
R7167:Reln UTSW 5 21,942,620 (GRCm38) missense probably damaging 1.00
R7190:Reln UTSW 5 22,047,947 (GRCm38) missense probably damaging 1.00
R7256:Reln UTSW 5 21,978,923 (GRCm38) missense probably benign 0.03
R7393:Reln UTSW 5 21,976,351 (GRCm38) missense probably damaging 0.99
R7399:Reln UTSW 5 22,051,367 (GRCm38) missense probably damaging 0.99
R7400:Reln UTSW 5 21,971,934 (GRCm38) missense probably damaging 0.99
R7426:Reln UTSW 5 21,971,953 (GRCm38) missense probably damaging 1.00
R7463:Reln UTSW 5 22,103,435 (GRCm38) missense probably damaging 0.98
R7470:Reln UTSW 5 21,942,741 (GRCm38) missense probably damaging 0.99
R7473:Reln UTSW 5 21,929,127 (GRCm38) missense probably benign 0.25
R7501:Reln UTSW 5 22,227,638 (GRCm38) missense possibly damaging 0.91
R7542:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R7544:Reln UTSW 5 21,976,278 (GRCm38) nonsense probably null
R7588:Reln UTSW 5 21,885,568 (GRCm38) missense probably benign 0.03
R7631:Reln UTSW 5 21,971,935 (GRCm38) missense probably damaging 0.97
R7644:Reln UTSW 5 21,978,931 (GRCm38) missense probably benign 0.39
R7834:Reln UTSW 5 22,039,635 (GRCm38) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,134,692 (GRCm38) missense probably benign 0.00
R7938:Reln UTSW 5 21,950,872 (GRCm38) missense probably damaging 0.97
R8006:Reln UTSW 5 21,899,084 (GRCm38) nonsense probably null
R8062:Reln UTSW 5 21,971,992 (GRCm38) missense probably benign 0.00
R8222:Reln UTSW 5 21,931,477 (GRCm38) nonsense probably null
R8266:Reln UTSW 5 22,018,087 (GRCm38) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,004,112 (GRCm38) missense probably damaging 1.00
R8487:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R8523:Reln UTSW 5 22,004,231 (GRCm38) missense probably damaging 1.00
R8751:Reln UTSW 5 21,942,674 (GRCm38) missense probably benign 0.37
R8801:Reln UTSW 5 21,950,856 (GRCm38) missense possibly damaging 0.94
R8802:Reln UTSW 5 21,925,259 (GRCm38) missense probably damaging 0.98
R8978:Reln UTSW 5 21,885,514 (GRCm38) missense possibly damaging 0.85
R8988:Reln UTSW 5 21,899,157 (GRCm38) missense probably damaging 0.97
R8995:Reln UTSW 5 21,979,579 (GRCm38) missense probably benign 0.00
R9022:Reln UTSW 5 21,976,615 (GRCm38) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,048,038 (GRCm38) missense probably damaging 1.00
R9069:Reln UTSW 5 22,011,061 (GRCm38) missense probably damaging 1.00
R9089:Reln UTSW 5 21,925,200 (GRCm38) missense probably benign 0.01
R9126:Reln UTSW 5 21,955,196 (GRCm38) missense probably damaging 1.00
R9172:Reln UTSW 5 21,950,817 (GRCm38) critical splice donor site probably null
R9182:Reln UTSW 5 21,901,619 (GRCm38) missense probably benign 0.44
R9196:Reln UTSW 5 22,152,473 (GRCm38) missense probably damaging 1.00
R9211:Reln UTSW 5 22,344,202 (GRCm38) nonsense probably null
R9241:Reln UTSW 5 21,969,069 (GRCm38) missense probably damaging 0.99
R9244:Reln UTSW 5 21,915,153 (GRCm38) missense probably damaging 0.99
R9281:Reln UTSW 5 21,948,547 (GRCm38) missense probably damaging 1.00
R9295:Reln UTSW 5 22,004,211 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 21,988,707 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,080,691 (GRCm38) missense probably benign 0.01
R9309:Reln UTSW 5 21,971,868 (GRCm38) missense probably benign 0.37
R9338:Reln UTSW 5 21,997,939 (GRCm38) missense probably damaging 0.98
R9381:Reln UTSW 5 22,344,204 (GRCm38) missense possibly damaging 0.93
R9430:Reln UTSW 5 21,915,107 (GRCm38) missense probably damaging 1.00
R9509:Reln UTSW 5 22,344,200 (GRCm38) missense possibly damaging 0.93
R9515:Reln UTSW 5 21,920,510 (GRCm38) missense possibly damaging 0.46
R9717:Reln UTSW 5 21,931,429 (GRCm38) missense probably benign 0.26
R9745:Reln UTSW 5 21,947,527 (GRCm38) missense probably damaging 1.00
R9778:Reln UTSW 5 21,950,945 (GRCm38) missense probably damaging 1.00
Z1176:Reln UTSW 5 21,979,024 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,004,082 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 21,969,241 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,227,636 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,154,959 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGAGATCTTAGACGACCTGTATCC -3'
(R):5'- CTGTATACCTGTCAGTTAATATCCATG -3'

Sequencing Primer
(F):5'- AGACGACCTGTATCCTTCTGGTG -3'
(R):5'- CCTTGCTAAATCTATCATCCGA -3'
Posted On 2015-06-20