Incidental Mutation 'R4297:Glipr1l1'
ID323396
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene NameGLI pathogenesis-related 1 like 1
Synonyms1700011E04Rik
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location112060189-112078510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112062347 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 119 (D119V)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073617]
Predicted Effect probably benign
Transcript: ENSMUST00000073617
AA Change: D119V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: D119V

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 112078381 missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 112072279 missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 112076169 missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 112060319 missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 112072236 splice site probably benign
P0031:Glipr1l1 UTSW 10 112060387 missense probably benign
R0987:Glipr1l1 UTSW 10 112078435 missense probably benign
R0992:Glipr1l1 UTSW 10 112062325 missense probably benign
R2136:Glipr1l1 UTSW 10 112060476 missense probably damaging 1.00
R2248:Glipr1l1 UTSW 10 112062287 missense probably benign 0.09
R4298:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 112062412 missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 112078374 missense probably benign 0.00
R5552:Glipr1l1 UTSW 10 112062338 missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 112078403 missense possibly damaging 0.90
R6061:Glipr1l1 UTSW 10 112076170 missense probably benign 0.32
R6237:Glipr1l1 UTSW 10 112060427 nonsense probably null
R6519:Glipr1l1 UTSW 10 112062248 missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 112062434 critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 112060395 missense probably benign 0.00
X0023:Glipr1l1 UTSW 10 112078439 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCAAGTAACCATGCCTGTC -3'
(R):5'- TGGAATCCCCATTAAGAGGAGG -3'

Sequencing Primer
(F):5'- ATGCCTGTCCCCTCTGAAATGG -3'
(R):5'- GCCAAGTACATACCTGTGT -3'
Posted On2015-06-20