Incidental Mutation 'R4297:Dgke'
ID323397
Institutional Source Beutler Lab
Gene Symbol Dgke
Ensembl Gene ENSMUSG00000000276
Gene Namediacylglycerol kinase, epsilon
SynonymsDAGK6
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location89035179-89066850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89050730 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 273 (V273D)
Ref Sequence ENSEMBL: ENSMUSP00000116277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000285] [ENSMUST00000107894] [ENSMUST00000152772]
Predicted Effect probably damaging
Transcript: ENSMUST00000000285
AA Change: V273D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000285
Gene: ENSMUSG00000000276
AA Change: V273D

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
C1 56 106 1.82e-4 SMART
C1 122 174 1.78e-7 SMART
DAGKc 216 347 3.69e-55 SMART
DAGKa 366 521 4.8e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107894
AA Change: V273D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103526
Gene: ENSMUSG00000000276
AA Change: V273D

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
C1 56 106 1.82e-4 SMART
C1 122 174 1.78e-7 SMART
DAGKc 216 347 3.69e-55 SMART
DAGKa 366 521 4.8e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152772
AA Change: V273D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116277
Gene: ENSMUSG00000000276
AA Change: V273D

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
C1 56 106 1.82e-4 SMART
C1 122 174 1.78e-7 SMART
DAGKc 216 347 3.69e-55 SMART
Pfam:DAGK_acc 366 406 9.7e-15 PFAM
Meta Mutation Damage Score 0.9710 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases are thought to be involved mainly in the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. When expressed in mammalian cells, DGK-epsilon shows specificity for arachidonyl-containing diacylglycerol. DGK-epsilon is expressed predominantly in testis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit reductions in susceptibility to electroconvulsive shock and arachidonoyldiacylglycerol accumulation in cerebral cortex, and attenuated long-term potentiation in dentate granular cell synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Dgke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Dgke APN 11 89041501 missense probably benign 0.02
IGL00548:Dgke APN 11 89055371 missense probably benign
IGL01366:Dgke APN 11 89055386 missense probably benign 0.25
IGL01682:Dgke APN 11 89052441 missense probably damaging 1.00
IGL02942:Dgke APN 11 89055369 missense probably benign
R0479:Dgke UTSW 11 89052470 missense probably benign 0.01
R0653:Dgke UTSW 11 89060169 missense probably benign 0.01
R0735:Dgke UTSW 11 89060075 missense probably benign 0.18
R1471:Dgke UTSW 11 89055494 missense possibly damaging 0.76
R2267:Dgke UTSW 11 89052469 missense probably benign 0.00
R4963:Dgke UTSW 11 89050802 missense possibly damaging 0.78
R5222:Dgke UTSW 11 89050394 missense probably benign 0.00
R5240:Dgke UTSW 11 89050685 missense probably damaging 1.00
R5864:Dgke UTSW 11 89050462 nonsense probably null
R6267:Dgke UTSW 11 89040749 missense probably benign
R6296:Dgke UTSW 11 89040749 missense probably benign
R6851:Dgke UTSW 11 89052483 missense probably benign 0.15
R7204:Dgke UTSW 11 89041480 missense probably damaging 1.00
R7216:Dgke UTSW 11 89050337 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGACACGCTGCAGACTTTG -3'
(R):5'- TGTCTCTGAGAACTGCAAAAGGG -3'

Sequencing Primer
(F):5'- TGTAAGGACTAATGTAACAAAGACAC -3'
(R):5'- GAAATAGGTAACAGCCTGTAAGGTG -3'
Posted On2015-06-20