Incidental Mutation 'R4297:Creld2'
ID323398
Institutional Source Beutler Lab
Gene Symbol Creld2
Ensembl Gene ENSMUSG00000023272
Gene Namecysteine-rich with EGF-like domains 2
Synonyms
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4297 (G1)
Quality Score207
Status Validated
Chromosome15
Chromosomal Location88819646-88826683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88823753 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 232 (C232R)
Ref Sequence ENSEMBL: ENSMUSP00000024042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024042] [ENSMUST00000043087] [ENSMUST00000159328] [ENSMUST00000162183]
Predicted Effect probably damaging
Transcript: ENSMUST00000024042
AA Change: C232R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024042
Gene: ENSMUSG00000023272
AA Change: C232R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF3456 28 86 1.3e-7 PFAM
low complexity region 90 100 N/A INTRINSIC
EGF 137 176 3.76e-1 SMART
FU 191 238 1.2e-7 SMART
EGF_like 228 273 1.76e-3 SMART
FU 251 298 5.08e-6 SMART
EGF_CA 288 329 3.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043087
SMART Domains Protein: ENSMUSP00000043480
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 267 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159328
SMART Domains Protein: ENSMUSP00000125534
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 169 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162183
SMART Domains Protein: ENSMUSP00000123935
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 406 3.3e-44 PFAM
Meta Mutation Damage Score 0.9736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Creld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Creld2 UTSW 15 88819956 missense probably damaging 1.00
R1137:Creld2 UTSW 15 88820631 nonsense probably null
R1163:Creld2 UTSW 15 88820631 nonsense probably null
R1164:Creld2 UTSW 15 88820631 nonsense probably null
R1206:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1457:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R1475:Creld2 UTSW 15 88820631 nonsense probably null
R1915:Creld2 UTSW 15 88820631 nonsense probably null
R2105:Creld2 UTSW 15 88820631 nonsense probably null
R5843:Creld2 UTSW 15 88826429 missense probably damaging 1.00
R6066:Creld2 UTSW 15 88823766 missense possibly damaging 0.95
R6402:Creld2 UTSW 15 88823141 missense probably damaging 0.99
R6454:Creld2 UTSW 15 88823071 nonsense probably null
R6543:Creld2 UTSW 15 88825278 missense probably benign 0.00
R6808:Creld2 UTSW 15 88825210 missense probably damaging 1.00
R6912:Creld2 UTSW 15 88819997 missense probably damaging 1.00
R7342:Creld2 UTSW 15 88826407 missense probably benign 0.03
R8058:Creld2 UTSW 15 88826429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAAGCTGGTCTAAAGCC -3'
(R):5'- TAAGTGACGCATGGAGATGTGC -3'

Sequencing Primer
(F):5'- CAAGCTGGTCTAAAGCCTTGGG -3'
(R):5'- ACTGATGTCGCCACTTTCAGG -3'
Posted On2015-06-20