Incidental Mutation 'R0003:Trim25'
ID32340
Institutional Source Beutler Lab
Gene Symbol Trim25
Ensembl Gene ENSMUSG00000000275
Gene Nametripartite motif-containing 25
Synonymsestrogen-responsive finger protein, Zfp147
MMRRC Submission 038299-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0003 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88999376-89020293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89015772 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 437 (V437L)
Ref Sequence ENSEMBL: ENSMUSP00000000284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000284] [ENSMUST00000100627] [ENSMUST00000107896]
Predicted Effect probably benign
Transcript: ENSMUST00000000284
AA Change: V437L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000000284
Gene: ENSMUSG00000000275
AA Change: V437L

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 5e-34 BLAST
PDB:4LTB|B 189 380 7e-69 PDB
PRY 453 505 3.44e-17 SMART
SPRY 506 626 9.62e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100627
SMART Domains Protein: ENSMUSP00000098192
Gene: ENSMUSG00000000275

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:BBOX 151 186 3e-8 BLAST
Blast:SPEC 189 288 2e-37 BLAST
PDB:4LTB|B 189 380 2e-71 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107896
AA Change: V445L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103528
Gene: ENSMUSG00000000275
AA Change: V445L

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 3e-34 BLAST
PDB:4LTB|B 189 380 8e-69 PDB
low complexity region 382 393 N/A INTRINSIC
PRY 461 513 3.44e-17 SMART
SPRY 514 634 9.62e-31 SMART
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations result in a compromised response to estrogen resulting in functional but small uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dock1 T C 7: 134,730,064 probably benign Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Igf1r T C 7: 68,165,242 V297A probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lama5 T G 2: 180,178,079 probably null Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Tpp2 T A 1: 43,960,139 S358T possibly damaging Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr11 G T 7: 129,599,061 G79C probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Trim25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Trim25 APN 11 88999691 missense probably damaging 0.96
IGL02398:Trim25 APN 11 88999804 missense probably damaging 1.00
IGL03150:Trim25 APN 11 89000005 missense probably damaging 1.00
R0184:Trim25 UTSW 11 88999640 missense probably damaging 1.00
R0707:Trim25 UTSW 11 88999738 missense probably benign 0.03
R1855:Trim25 UTSW 11 89015581 missense probably benign 0.04
R1936:Trim25 UTSW 11 89004750 missense probably benign 0.03
R2229:Trim25 UTSW 11 89016621 missense probably damaging 0.97
R3401:Trim25 UTSW 11 89010881 missense probably benign
R5159:Trim25 UTSW 11 88999532 missense probably benign 0.20
R5378:Trim25 UTSW 11 89009267 missense probably damaging 1.00
R6149:Trim25 UTSW 11 89015536 missense probably benign 0.00
R6867:Trim25 UTSW 11 89010887 missense probably benign 0.00
R6996:Trim25 UTSW 11 88999503 missense probably benign 0.00
R7055:Trim25 UTSW 11 88999924 missense probably benign
R7310:Trim25 UTSW 11 89015782 missense probably benign 0.03
R7451:Trim25 UTSW 11 89015737 missense possibly damaging 0.76
X0022:Trim25 UTSW 11 89015596 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACTTCCCCTGATGGTGAGTGGTG -3'
(R):5'- TTTGACAAGGGACCCAAGGTGC -3'

Sequencing Primer
(F):5'- ACCATTTGTCCTGAGTTCCC -3'
(R):5'- cccatccatccatccatctac -3'
Posted On2013-05-09