Incidental Mutation 'R4298:Nyap2'
ID323404
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Nameneuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
SynonymsJr6, 9430031J16Rik
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location81076950-81341764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81241096 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 278 (I278F)
Ref Sequence ENSEMBL: ENSMUSP00000065468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068275] [ENSMUST00000113494] [ENSMUST00000123285] [ENSMUST00000123720] [ENSMUST00000137862]
Predicted Effect probably damaging
Transcript: ENSMUST00000068275
AA Change: I278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065468
Gene: ENSMUSG00000054976
AA Change: I278F

DomainStartEndE-ValueType
Pfam:NYAP_N 44 447 1.5e-139 PFAM
Pfam:NYAP_C 496 709 5.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113494
AA Change: I246F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109122
Gene: ENSMUSG00000054976
AA Change: I246F

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123285
AA Change: I246F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976
AA Change: I246F

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123720
AA Change: I278F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117661
Gene: ENSMUSG00000054976
AA Change: I278F

DomainStartEndE-ValueType
Pfam:NYAP_N 43 448 1.9e-127 PFAM
low complexity region 489 510 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
low complexity region 649 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137862
AA Change: I246F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120767
Gene: ENSMUSG00000054976
AA Change: I246F

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Meta Mutation Damage Score 0.2397 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81191980 missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81191927 missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81087430 missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81241720 missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81087322 missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81241441 missense possibly damaging 0.95
R0001:Nyap2 UTSW 1 81192107 missense probably benign 0.03
R0014:Nyap2 UTSW 1 81241951 missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81087312 missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81241851 missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81191887 missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81191872 missense probably benign 0.03
R2078:Nyap2 UTSW 1 81191981 missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81241268 missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81087471 nonsense probably null
R2972:Nyap2 UTSW 1 81191770 nonsense probably null
R2974:Nyap2 UTSW 1 81191770 nonsense probably null
R3076:Nyap2 UTSW 1 81241971 critical splice donor site probably null
R4066:Nyap2 UTSW 1 81241835 missense probably damaging 1.00
R4134:Nyap2 UTSW 1 81241193 missense probably damaging 0.99
R4652:Nyap2 UTSW 1 81336729 missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81269397 missense probably benign
R4816:Nyap2 UTSW 1 81241313 missense probably damaging 1.00
R5211:Nyap2 UTSW 1 81087274 start codon destroyed probably null 0.77
R5327:Nyap2 UTSW 1 81192041 missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81192142 missense probably benign 0.01
R7337:Nyap2 UTSW 1 81336515 missense possibly damaging 0.50
R7558:Nyap2 UTSW 1 81269373 missense probably benign 0.01
R8078:Nyap2 UTSW 1 81241057 missense possibly damaging 0.95
R8231:Nyap2 UTSW 1 81192131 missense probably benign
R8482:Nyap2 UTSW 1 81241637 missense probably damaging 1.00
X0067:Nyap2 UTSW 1 81269319 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCAGTGTCTGCCAAGCCAAG -3'
(R):5'- TTGACAAAGTCCAGGTCAGG -3'

Sequencing Primer
(F):5'- AGACCCCACAGTGATGAATATTC -3'
(R):5'- TCAGGCACCGTGGGAGTAG -3'
Posted On2015-06-20