Incidental Mutation 'R4298:Dusp12'
ID323406
Institutional Source Beutler Lab
Gene Symbol Dusp12
Ensembl Gene ENSMUSG00000026659
Gene Namedual specificity phosphatase 12
SynonymsT-DSP4, ESTM36, VH1, LMW-DSP4, mVH1, 1190004O14Rik
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170873498-170885540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 170880629 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 173 (T173M)
Ref Sequence ENSEMBL: ENSMUSP00000027970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027970] [ENSMUST00000046476] [ENSMUST00000163252] [ENSMUST00000170420] [ENSMUST00000172042] [ENSMUST00000180542]
Predicted Effect probably benign
Transcript: ENSMUST00000027970
AA Change: T173M

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027970
Gene: ENSMUSG00000026659
AA Change: T173M

DomainStartEndE-ValueType
DSPc 26 167 1.23e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046476
SMART Domains Protein: ENSMUSP00000044320
Gene: ENSMUSG00000026659

DomainStartEndE-ValueType
DSPc 26 157 5.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163252
SMART Domains Protein: ENSMUSP00000126676
Gene: ENSMUSG00000026659

DomainStartEndE-ValueType
Pfam:DSPc 30 115 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166393
SMART Domains Protein: ENSMUSP00000130507
Gene: ENSMUSG00000026659

DomainStartEndE-ValueType
Pfam:DSPc 31 121 8.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170420
SMART Domains Protein: ENSMUSP00000129515
Gene: ENSMUSG00000026659

DomainStartEndE-ValueType
PTPc_DSPc 26 136 4e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171447
AA Change: T103M
SMART Domains Protein: ENSMUSP00000130683
Gene: ENSMUSG00000026659
AA Change: T103M

DomainStartEndE-ValueType
Pfam:DSPc 3 98 6.9e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171747
Predicted Effect probably benign
Transcript: ENSMUST00000172042
Predicted Effect probably benign
Transcript: ENSMUST00000180542
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Dusp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Dusp12 APN 1 170874473 missense probably damaging 1.00
IGL02718:Dusp12 APN 1 170880657 missense probably damaging 1.00
P0028:Dusp12 UTSW 1 170879817 nonsense probably null
R0040:Dusp12 UTSW 1 170880657 missense probably damaging 1.00
R0040:Dusp12 UTSW 1 170880657 missense probably damaging 1.00
R1114:Dusp12 UTSW 1 170881017 missense probably damaging 1.00
R1833:Dusp12 UTSW 1 170874453 missense probably benign
R1850:Dusp12 UTSW 1 170880629 missense probably benign 0.12
R2138:Dusp12 UTSW 1 170880597 nonsense probably null
R2260:Dusp12 UTSW 1 170881011 missense probably damaging 1.00
R3972:Dusp12 UTSW 1 170879775 missense probably damaging 0.98
R4803:Dusp12 UTSW 1 170880606 missense possibly damaging 0.51
R6639:Dusp12 UTSW 1 170880674 missense probably damaging 1.00
R6674:Dusp12 UTSW 1 170879748 missense probably benign 0.13
R6981:Dusp12 UTSW 1 170880961 missense probably damaging 1.00
R7432:Dusp12 UTSW 1 170879776 nonsense probably null
R7861:Dusp12 UTSW 1 170874526 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGATTTCAGTCCCAGC -3'
(R):5'- GCACTTCCATTGGCCAAAGG -3'

Sequencing Primer
(F):5'- CGTGACTTTCTGCTCAACAAAAGG -3'
(R):5'- AGGCCAACTTAGGGTCTTCC -3'
Posted On2015-06-20