Mutagenetix > Incidental Mutations

Incidental Mutation 'R4298:Dusp12'

323406

Institutional Source

Beutler Lab

Gene Symbol

Dusp12

Ensembl Gene

ENSMUSG00000026659

Gene Name

dual specificity phosphatase 12

Synonyms

T-DSP4, ESTM36, VH1, LMW-DSP4, mVH1, 1190004O14Rik

MMRRC Submission

041086-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170873498-170885540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 170880629 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 173 (T173M)

Ref Sequence

ENSEMBL: ENSMUSP00000027970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027970] [ENSMUST00000046476] [ENSMUST00000163252] [ENSMUST00000170420] [ENSMUST00000172042] [ENSMUST00000180542]

Predicted Effect

probably benign
Transcript: ENSMUST00000027970
AA Change: T173M

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000027970
Gene: ENSMUSG00000026659
AA Change: T173M

Domain	Start	End	E-Value	Type
DSPc	26	167	1.23e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000046476

SMART Domains

Protein: ENSMUSP00000044320
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
DSPc	26	157	5.96e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163252

SMART Domains

Protein: ENSMUSP00000126676
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
Pfam:DSPc	30	115	2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166393

SMART Domains

Protein: ENSMUSP00000130507
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
Pfam:DSPc	31	121	8.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170420

SMART Domains

Protein: ENSMUSP00000129515
Gene: ENSMUSG00000026659

Domain	Start	End	E-Value	Type
PTPc_DSPc	26	136	4e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000171447
AA Change: T103M

SMART Domains

Protein: ENSMUSP00000130683
Gene: ENSMUSG00000026659
AA Change: T103M

Domain	Start	End	E-Value	Type
Pfam:DSPc	3	98	6.9e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171747

Predicted Effect

probably benign
Transcript: ENSMUST00000172042

Predicted Effect

probably benign
Transcript: ENSMUST00000180542

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Ebf3	C	T	7: 137,225,229	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr1263	A	T	2: 90,015,649	T240S	probably benign	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,401,827	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Dusp12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01104:Dusp12	APN	1	170874473	missense	probably damaging	1.00
IGL02718:Dusp12	APN	1	170880657	missense	probably damaging	1.00
P0028:Dusp12	UTSW	1	170879817	nonsense	probably null
R0040:Dusp12	UTSW	1	170880657	missense	probably damaging	1.00
R0040:Dusp12	UTSW	1	170880657	missense	probably damaging	1.00
R1114:Dusp12	UTSW	1	170881017	missense	probably damaging	1.00
R1833:Dusp12	UTSW	1	170874453	missense	probably benign
R1850:Dusp12	UTSW	1	170880629	missense	probably benign	0.12
R2138:Dusp12	UTSW	1	170880597	nonsense	probably null
R2260:Dusp12	UTSW	1	170881011	missense	probably damaging	1.00
R3972:Dusp12	UTSW	1	170879775	missense	probably damaging	0.98
R4803:Dusp12	UTSW	1	170880606	missense	possibly damaging	0.51
R6639:Dusp12	UTSW	1	170880674	missense	probably damaging	1.00
R6674:Dusp12	UTSW	1	170879748	missense	probably benign	0.13
R6981:Dusp12	UTSW	1	170880961	missense	probably damaging	1.00
R7432:Dusp12	UTSW	1	170879776	nonsense	probably null
R7861:Dusp12	UTSW	1	170874526	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCTGATTTCAGTCCCAGC -3'
(R):5'- GCACTTCCATTGGCCAAAGG -3'

Sequencing Primer
(F):5'- CGTGACTTTCTGCTCAACAAAAGG -3'
(R):5'- AGGCCAACTTAGGGTCTTCC -3'

Posted On

2015-06-20