Incidental Mutation 'R4298:Stk39'
ID323408
Institutional Source Beutler Lab
Gene Symbol Stk39
Ensembl Gene ENSMUSG00000027030
Gene Nameserine/threonine kinase 39
SynonymsDCHT, Rnl5, RF005, SPAK
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68210445-68472268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68390940 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 213 (G213D)
Ref Sequence ENSEMBL: ENSMUSP00000099776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102715]
Predicted Effect probably damaging
Transcript: ENSMUST00000102715
AA Change: G213D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: G213D

DomainStartEndE-ValueType
low complexity region 14 65 N/A INTRINSIC
S_TKc 75 349 4.44e-80 SMART
Pfam:OSR1_C 463 494 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149581
Meta Mutation Damage Score 0.1380 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Stk39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Stk39 APN 2 68314564 missense possibly damaging 0.81
IGL00966:Stk39 APN 2 68211958 missense probably benign 0.01
IGL01936:Stk39 APN 2 68314564 missense probably benign 0.21
IGL02301:Stk39 APN 2 68211962 missense probably damaging 1.00
IGL02940:Stk39 APN 2 68220899 splice site probably null
claimjumper UTSW 2 68314579 missense probably damaging 0.96
outlaw UTSW 2 68307039 critical splice donor site probably null
rustler UTSW 2 68263303 missense probably damaging 1.00
R0570:Stk39 UTSW 2 68410048 missense probably damaging 1.00
R0609:Stk39 UTSW 2 68366167 missense probably damaging 1.00
R0670:Stk39 UTSW 2 68366182 missense possibly damaging 0.93
R0980:Stk39 UTSW 2 68392171 missense probably damaging 1.00
R1024:Stk39 UTSW 2 68410046 missense probably damaging 1.00
R1573:Stk39 UTSW 2 68390949 missense probably damaging 1.00
R1713:Stk39 UTSW 2 68307116 splice site probably benign
R2223:Stk39 UTSW 2 68314579 missense probably damaging 0.96
R3700:Stk39 UTSW 2 68392118 missense probably damaging 1.00
R4207:Stk39 UTSW 2 68220920 missense probably benign 0.42
R4726:Stk39 UTSW 2 68263303 missense probably damaging 1.00
R4975:Stk39 UTSW 2 68220992 intron probably benign
R5057:Stk39 UTSW 2 68220948 missense probably damaging 0.99
R5384:Stk39 UTSW 2 68410039 missense probably damaging 1.00
R5921:Stk39 UTSW 2 68366105 missense probably damaging 0.97
R6125:Stk39 UTSW 2 68392124 missense probably damaging 1.00
R6251:Stk39 UTSW 2 68307039 critical splice donor site probably null
R6332:Stk39 UTSW 2 68410043 missense possibly damaging 0.93
R6375:Stk39 UTSW 2 68392238 missense probably benign 0.34
R7057:Stk39 UTSW 2 68410127 missense possibly damaging 0.88
R7064:Stk39 UTSW 2 68358812 critical splice donor site probably null
R7691:Stk39 UTSW 2 68471639 missense probably damaging 0.97
R7921:Stk39 UTSW 2 68307039 critical splice donor site probably null
R8155:Stk39 UTSW 2 68267066 missense probably damaging 1.00
Z1176:Stk39 UTSW 2 68392198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCAGATCGAGCCAAGATTC -3'
(R):5'- CTGCAGCGTGGCTTTAATATTC -3'

Sequencing Primer
(F):5'- TCAGTCCCAGGCATTCCGTAAG -3'
(R):5'- GCGTCATAGCTAACCTGT -3'
Posted On2015-06-20