Mutagenetix > Incidental Mutations

Incidental Mutation 'R4298:Olfr1263'

323410

Institutional Source

Beutler Lab

Gene Symbol

Olfr1263

Ensembl Gene

ENSMUSG00000059112

Gene Name

olfactory receptor 1263

Synonyms

MOR234-2, GA_x6K02T2Q125-51447049-51447969

MMRRC Submission

041086-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90012131-90018424 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90015649 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 240 (T240S)

Ref Sequence

ENSEMBL: ENSMUSP00000150959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111507] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]

Predicted Effect

probably benign
Transcript: ENSMUST00000111507
AA Change: T240S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000107132
Gene: ENSMUSG00000059112
AA Change: T240S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	25	299	7.6e-42	PFAM
Pfam:7TM_GPCR_Srsx	30	297	1.7e-5	PFAM
Pfam:7tm_1	36	282	2.3e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214382
AA Change: T240S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000216616

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216764

Predicted Effect

probably benign
Transcript: ENSMUST00000217065
AA Change: T240S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Ebf3	C	T	7: 137,225,229	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,401,827	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Olfr1263

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:Olfr1263	APN	2	90015719	missense	probably damaging	1.00
IGL01512:Olfr1263	APN	2	90015292	missense	probably damaging	1.00
IGL01722:Olfr1263	APN	2	90015007	missense	probably benign	0.39
IGL01787:Olfr1263	APN	2	90015311	missense	probably damaging	1.00
IGL02376:Olfr1263	APN	2	90015460	missense	probably benign	0.00
IGL03408:Olfr1263	APN	2	90015571	missense	probably benign	0.35
R0367:Olfr1263	UTSW	2	90015772	missense	probably damaging	0.99
R0765:Olfr1263	UTSW	2	90015670	missense	probably benign	0.01
R1158:Olfr1263	UTSW	2	90015254	missense	possibly damaging	0.94
R1705:Olfr1263	UTSW	2	90015511	missense	possibly damaging	0.90
R1794:Olfr1263	UTSW	2	90015020	missense	probably damaging	1.00
R2197:Olfr1263	UTSW	2	90015424	missense	probably damaging	1.00
R2347:Olfr1263	UTSW	2	90015614	missense	possibly damaging	0.82
R2442:Olfr1263	UTSW	2	90015341	missense	probably benign
R3160:Olfr1263	UTSW	2	90015021	nonsense	probably null
R3162:Olfr1263	UTSW	2	90015021	nonsense	probably null
R4898:Olfr1263	UTSW	2	90015418	missense	probably damaging	1.00
R5340:Olfr1263	UTSW	2	90015362	missense	probably benign
R6280:Olfr1263	UTSW	2	90015049	missense	possibly damaging	0.62
R6367:Olfr1263	UTSW	2	90015016	missense	probably benign	0.00
R6556:Olfr1263	UTSW	2	90015094	missense	probably damaging	1.00
R7086:Olfr1263	UTSW	2	90015250	missense	probably benign	0.07
R7502:Olfr1263	UTSW	2	90015011	missense	probably benign	0.15
R7585:Olfr1263	UTSW	2	90015049	missense	probably damaging	0.99
R7963:Olfr1263	UTSW	2	90015659	missense	possibly damaging	0.73
R8062:Olfr1263	UTSW	2	90015736	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TAATACCACTCCTGGAGTTGGC -3'
(R):5'- CAGGATTACATGTCACCAGCTTTC -3'

Sequencing Primer
(F):5'- AGTTGGCCTGCACTGACACTC -3'
(R):5'- ATTCGACCCCAGAGCTTCTTCATAAC -3'

Posted On

2015-06-20