Incidental Mutation 'R4298:F2'
ID323411
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Namecoagulation factor II
SynonymsFII, Cf2, Cf-2, thrombin, prothrombin
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91625320-91636414 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 91629320 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000028681] [ENSMUST00000111335] [ENSMUST00000111335]
Predicted Effect probably null
Transcript: ENSMUST00000028681
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028681
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111335
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111335
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153182
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91633094 missense probably benign 0.16
IGL02390:F2 APN 2 91632987 missense possibly damaging 0.81
IGL02859:F2 APN 2 91625742 missense probably damaging 1.00
IGL02970:F2 APN 2 91625551 missense possibly damaging 0.95
IGL03278:F2 APN 2 91635182 missense probably benign 0.01
Sarode UTSW 2 91635194 missense probably benign 0.35
R0007:F2 UTSW 2 91630607 missense probably benign 0.00
R0015:F2 UTSW 2 91630607 missense probably benign 0.00
R0137:F2 UTSW 2 91625730 missense probably damaging 1.00
R0211:F2 UTSW 2 91630158 missense probably damaging 1.00
R0304:F2 UTSW 2 91633233 missense probably damaging 0.99
R0601:F2 UTSW 2 91633311 splice site probably null
R0830:F2 UTSW 2 91630200 missense probably benign 0.34
R1693:F2 UTSW 2 91629179 missense probably damaging 1.00
R1720:F2 UTSW 2 91628830 nonsense probably null
R1763:F2 UTSW 2 91634906 missense probably damaging 1.00
R1865:F2 UTSW 2 91635194 missense probably benign 0.35
R1955:F2 UTSW 2 91633095 missense probably benign 0.01
R2055:F2 UTSW 2 91628442 missense probably benign 0.00
R2168:F2 UTSW 2 91628348 missense probably damaging 0.98
R2230:F2 UTSW 2 91625757 missense probably benign 0.01
R3916:F2 UTSW 2 91625488 missense probably damaging 1.00
R4004:F2 UTSW 2 91628396 missense possibly damaging 0.88
R4134:F2 UTSW 2 91629208 missense possibly damaging 0.93
R4626:F2 UTSW 2 91630670 missense probably benign 0.07
R4902:F2 UTSW 2 91634971 intron probably benign
R5093:F2 UTSW 2 91634957 splice site probably benign
R5095:F2 UTSW 2 91634957 splice site probably benign
R5140:F2 UTSW 2 91634957 splice site probably benign
R5229:F2 UTSW 2 91630241 nonsense probably null
R5271:F2 UTSW 2 91635121 intron probably benign
R5335:F2 UTSW 2 91634932 missense possibly damaging 0.68
R7650:F2 UTSW 2 91628396 missense possibly damaging 0.88
R7762:F2 UTSW 2 91628696 missense possibly damaging 0.61
R8178:F2 UTSW 2 91630273 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGTTCGGGAATGCTTG -3'
(R):5'- TCAATCCGAGATTTGAGCCCTG -3'

Sequencing Primer
(F):5'- AATGCTTGCCAATGCGC -3'
(R):5'- GCGAGGGGAGGTCTTATATAGC -3'
Posted On2015-06-20