Incidental Mutation 'R4298:Col9a2'
ID 323418
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission 041086-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4298 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 120911455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 599 (R599G)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.3183 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 87,258,154 (GRCm39) probably null Het
Ccser2 T A 14: 36,612,337 (GRCm39) Q158L possibly damaging Het
Cct7 T A 6: 85,445,155 (GRCm39) C469S probably damaging Het
Chmp7 A T 14: 69,956,650 (GRCm39) probably null Het
Clcn4 C T 7: 7,299,737 (GRCm39) D31N possibly damaging Het
Ctdp1 A T 18: 80,493,172 (GRCm39) V441E probably benign Het
Cyp4a10 T C 4: 115,389,889 (GRCm39) L498P probably damaging Het
Dsc3 A T 18: 20,113,811 (GRCm39) N370K possibly damaging Het
Dusp12 G A 1: 170,708,198 (GRCm39) T173M probably benign Het
Ebf3 C T 7: 136,826,958 (GRCm39) R318Q possibly damaging Het
Epcam T C 17: 87,947,962 (GRCm39) probably null Het
Erich6 G T 3: 58,531,712 (GRCm39) A428D probably benign Het
Ext1 A T 15: 53,208,521 (GRCm39) I80N probably benign Het
Extl1 T C 4: 134,084,969 (GRCm39) E667G probably damaging Het
F2 T G 2: 91,459,665 (GRCm39) probably null Het
Fbxw16 T C 9: 109,275,625 (GRCm39) I135V probably benign Het
Glipr1l1 A T 10: 111,898,252 (GRCm39) D119V probably benign Het
Gprc5b G A 7: 118,583,437 (GRCm39) A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,882 (GRCm39) R252H possibly damaging Het
Lyst A G 13: 13,809,472 (GRCm39) T381A probably damaging Het
Mcpt4 A T 14: 56,298,444 (GRCm39) V97D possibly damaging Het
Nefh A G 11: 4,890,066 (GRCm39) I851T probably benign Het
Nf1 A T 11: 79,275,070 (GRCm39) I44F probably damaging Het
Nyap2 A T 1: 81,218,811 (GRCm39) I278F probably damaging Het
Or4c52 A T 2: 89,845,993 (GRCm39) T240S probably benign Het
Or4f7d-ps1 G T 2: 111,674,789 (GRCm39) noncoding transcript Het
Pdcd4 C A 19: 53,908,092 (GRCm39) P201Q probably damaging Het
Pramel16 A T 4: 143,675,713 (GRCm39) L371* probably null Het
Prdm11 T C 2: 92,823,728 (GRCm39) T179A probably benign Het
Qrfpr T A 3: 36,243,703 (GRCm39) I133F probably damaging Het
Rack1 T C 11: 48,692,453 (GRCm39) probably benign Het
Reln A C 5: 22,125,485 (GRCm39) C2733G probably damaging Het
Rrs1 C T 1: 9,616,448 (GRCm39) R234C possibly damaging Het
Sag G C 1: 87,772,737 (GRCm39) D402H probably benign Het
Sbk3 T A 7: 4,972,979 (GRCm39) T64S probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Sh3gl1 C T 17: 56,326,173 (GRCm39) G111D probably damaging Het
Spata20 G A 11: 94,373,914 (GRCm39) R379W probably damaging Het
St3gal2 T C 8: 111,688,991 (GRCm39) M177T probably benign Het
Stk39 C T 2: 68,221,284 (GRCm39) G213D probably damaging Het
Szt2 A G 4: 118,222,603 (GRCm39) probably benign Het
Taf1d T C 9: 15,219,939 (GRCm39) S63P probably damaging Het
Tnfrsf13b C G 11: 61,031,643 (GRCm39) probably null Het
Ttn G T 2: 76,554,394 (GRCm39) A30807D probably damaging Het
Unc119 A G 11: 78,238,948 (GRCm39) N158S probably damaging Het
Vmn2r116 T A 17: 23,620,801 (GRCm39) I845N possibly damaging Het
Vmn2r12 C A 5: 109,239,830 (GRCm39) M244I probably benign Het
Zdhhc4 A G 5: 143,309,997 (GRCm39) V87A probably damaging Het
Zwilch A G 9: 64,062,444 (GRCm39) probably null Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTCCCAAATCTTATCTGGATC -3'
(R):5'- TCAAGAGTCCCAACTGCCAG -3'

Sequencing Primer
(F):5'- ATCTGGATCTCCCTTTATCTAACCAG -3'
(R):5'- AGAGACACCTCCAGCTTGG -3'
Posted On 2015-06-20