Incidental Mutation 'R4298:Extl1'
ID323419
Institutional Source Beutler Lab
Gene Symbol Extl1
Ensembl Gene ENSMUSG00000028838
Gene Nameexostoses (multiple)-like 1
SynonymsD430033M16Rik
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134356372-134383850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134357658 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 667 (E667G)
Ref Sequence ENSEMBL: ENSMUSP00000030643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030643] [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105873] [ENSMUST00000105874]
Predicted Effect probably damaging
Transcript: ENSMUST00000030643
AA Change: E667G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030643
Gene: ENSMUSG00000028838
AA Change: E667G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Exostosin 87 329 2.1e-38 PFAM
Pfam:Glyco_transf_64 412 652 1.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081094
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105872
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105873
SMART Domains Protein: ENSMUSP00000101499
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 74 311 3.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105874
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132387
Meta Mutation Damage Score 0.1320 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the multiple exostoses (EXT) family of glycosyltransferases, which function in the chain polymerization of heparan sulfate and heparin. The encoded protein harbors alpha 1,4- N-acetylglucosaminyltransferase activity, and is involved in chain elongation of heparan sulfate and possibly heparin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Extl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Extl1 APN 4 134358019 missense probably damaging 1.00
IGL01404:Extl1 APN 4 134359203 missense probably benign 0.06
IGL03040:Extl1 APN 4 134360629 splice site probably benign
R0165:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R0566:Extl1 UTSW 4 134357677 unclassified probably benign
R0575:Extl1 UTSW 4 134357677 unclassified probably benign
R0941:Extl1 UTSW 4 134357677 unclassified probably benign
R0943:Extl1 UTSW 4 134357677 unclassified probably benign
R0988:Extl1 UTSW 4 134357677 unclassified probably benign
R0989:Extl1 UTSW 4 134357677 unclassified probably benign
R0990:Extl1 UTSW 4 134357677 unclassified probably benign
R1022:Extl1 UTSW 4 134357677 unclassified probably benign
R1035:Extl1 UTSW 4 134357677 unclassified probably benign
R1344:Extl1 UTSW 4 134359241 missense probably damaging 0.99
R1495:Extl1 UTSW 4 134357677 unclassified probably benign
R1699:Extl1 UTSW 4 134364583 nonsense probably null
R1750:Extl1 UTSW 4 134362688 missense probably benign 0.00
R1768:Extl1 UTSW 4 134371138 missense probably benign
R1883:Extl1 UTSW 4 134364606 missense probably benign 0.01
R2143:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2144:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2155:Extl1 UTSW 4 134363180 missense possibly damaging 0.71
R4605:Extl1 UTSW 4 134359834 missense probably benign 0.00
R4606:Extl1 UTSW 4 134371379 missense probably damaging 0.99
R4606:Extl1 UTSW 4 134371380 missense probably benign 0.00
R4787:Extl1 UTSW 4 134364667 missense probably damaging 1.00
R5210:Extl1 UTSW 4 134360584 missense probably benign 0.02
R5776:Extl1 UTSW 4 134357772 missense possibly damaging 0.82
R6216:Extl1 UTSW 4 134363130 missense probably benign
R6392:Extl1 UTSW 4 134364634 missense probably benign 0.44
R6674:Extl1 UTSW 4 134358127 missense probably damaging 0.97
R7218:Extl1 UTSW 4 134359769 missense probably benign 0.14
R7779:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R7779:Extl1 UTSW 4 134360597 missense probably benign 0.25
R7795:Extl1 UTSW 4 134364679 missense probably damaging 1.00
R7800:Extl1 UTSW 4 134371618 missense probably benign 0.10
R8472:Extl1 UTSW 4 134371292 missense probably benign
X0020:Extl1 UTSW 4 134358021 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGAATCGTGCGAGGACTTC -3'
(R):5'- TCTTAGGATTCTGGGGATCCAC -3'

Sequencing Primer
(F):5'- CATTTCAGGGAACAGGATCAGCC -3'
(R):5'- ATTCTGGGGATCCACGACCAG -3'
Posted On2015-06-20