Incidental Mutation 'R4298:Zdhhc4'
ID323423
Institutional Source Beutler Lab
Gene Symbol Zdhhc4
Ensembl Gene ENSMUSG00000001844
Gene Namezinc finger, DHHC domain containing 4
Synonyms
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143316489-143329256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143324242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000124416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001900] [ENSMUST00000159813] [ENSMUST00000159941] [ENSMUST00000161915] [ENSMUST00000162066] [ENSMUST00000162358] [ENSMUST00000162941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001900
AA Change: V87A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001900
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 294 5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159718
Predicted Effect probably damaging
Transcript: ENSMUST00000159813
AA Change: V87A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137935
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 175 3.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159941
AA Change: V87A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124026
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 178 2.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161333
Predicted Effect possibly damaging
Transcript: ENSMUST00000161915
AA Change: V87A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124813
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
Pfam:zf-DHHC 144 294 9.7e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162066
AA Change: V87A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125130
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162287
Predicted Effect probably damaging
Transcript: ENSMUST00000162358
AA Change: V87A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124416
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162941
AA Change: V87A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124997
Gene: ENSMUSG00000001844
AA Change: V87A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 176 4.2e-14 PFAM
Meta Mutation Damage Score 0.8616 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Zdhhc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Zdhhc4 APN 5 143320391 missense probably damaging 1.00
R2022:Zdhhc4 UTSW 5 143321783 missense probably damaging 1.00
R2138:Zdhhc4 UTSW 5 143324262 nonsense probably null
R2228:Zdhhc4 UTSW 5 143320407 missense probably damaging 0.98
R4305:Zdhhc4 UTSW 5 143324344 intron probably benign
R4722:Zdhhc4 UTSW 5 143321781 missense probably damaging 1.00
R4773:Zdhhc4 UTSW 5 143326176 missense possibly damaging 0.50
R5000:Zdhhc4 UTSW 5 143324933 missense probably damaging 0.98
R5063:Zdhhc4 UTSW 5 143316622 missense probably damaging 1.00
R5341:Zdhhc4 UTSW 5 143326160 missense probably benign 0.01
R5945:Zdhhc4 UTSW 5 143324886 missense probably damaging 1.00
R5956:Zdhhc4 UTSW 5 143324849 intron probably benign
R7284:Zdhhc4 UTSW 5 143321891 missense probably benign 0.01
R7843:Zdhhc4 UTSW 5 143320276 missense probably damaging 1.00
R7955:Zdhhc4 UTSW 5 143321864 missense probably damaging 1.00
R8261:Zdhhc4 UTSW 5 143321833 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCAGAACATCTCACACTGGTG -3'
(R):5'- TAACCCTTACAGGAGGAGGTTG -3'

Sequencing Primer
(F):5'- TGGAACCGTAACATGGTCTC -3'
(R):5'- AGGAGGAGGTTGGCCCG -3'
Posted On2015-06-20