Incidental Mutation 'R4298:Clcn4'
ID323426
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Namechloride channel, voltage-sensitive 4
SynonymsClc4-2, Clcn4-2
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location7282309-7300851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7296738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 31 (D31N)
Ref Sequence ENSEMBL: ENSMUSP00000147449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: D31N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: D31N

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176903
Predicted Effect possibly damaging
Transcript: ENSMUST00000209916
AA Change: D31N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: D31N

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210318
Predicted Effect probably benign
Transcript: ENSMUST00000210362
AA Change: D31N

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210444
Predicted Effect probably benign
Transcript: ENSMUST00000210594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211551
Predicted Effect possibly damaging
Transcript: ENSMUST00000211574
AA Change: D31N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.2498 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7287673 missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7294036 missense probably benign 0.01
IGL01650:Clcn4 APN 7 7284281 splice site probably benign
IGL02404:Clcn4 APN 7 7287858 missense probably benign 0.04
IGL02493:Clcn4 APN 7 7284244 missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7296066 missense probably benign
IGL02661:Clcn4 APN 7 7291731 splice site probably null
IGL02816:Clcn4 APN 7 7295088 missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7290465 missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7290420 missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7284258 missense probably damaging 1.00
Delipidated UTSW 7 7293061 missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7295091 nonsense probably null
R0379:Clcn4 UTSW 7 7296792 missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7290504 missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7288965 missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7296764 nonsense probably null
R1549:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7293982 missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7284185 makesense probably null
R2764:Clcn4 UTSW 7 7296799 missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7290521 missense probably benign 0.33
R4023:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4154:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4535:Clcn4 UTSW 7 7287814 missense probably benign 0.01
R4574:Clcn4 UTSW 7 7287805 missense probably benign 0.23
R4977:Clcn4 UTSW 7 7291437 missense probably benign 0.00
R5158:Clcn4 UTSW 7 7291619 missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7294051 missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7296033 missense probably benign 0.26
R5624:Clcn4 UTSW 7 7288944 missense probably benign 0.35
R5626:Clcn4 UTSW 7 7289018 missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7291482 missense probably benign 0.00
R6259:Clcn4 UTSW 7 7291530 missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7294025 missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7299182 unclassified probably benign
R7320:Clcn4 UTSW 7 7291828 missense probably benign 0.19
R7562:Clcn4 UTSW 7 7295082 missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7293959 missense probably benign 0.00
R7752:Clcn4 UTSW 7 7293937 missense probably benign
R7860:Clcn4 UTSW 7 7293061 missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7287781 missense probably benign
R7895:Clcn4 UTSW 7 7295168 missense probably benign 0.26
R8069:Clcn4 UTSW 7 7296759 missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7291428 missense possibly damaging 0.69
X0019:Clcn4 UTSW 7 7291610 missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7293040 nonsense probably null
Z1177:Clcn4 UTSW 7 7294756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGGTATCTGCCATTGTCAC -3'
(R):5'- CTTAGTTTCTCGGTGGAGCC -3'

Sequencing Primer
(F):5'- AGGTATCTGCCATTGTCACTCTCAG -3'
(R):5'- GAGCCCCGTCTGCGTTTTTAAC -3'
Posted On2015-06-20