Mutagenetix > Incidental Mutations

Incidental Mutation 'R4298:Gprc5b'

323427

Institutional Source

Beutler Lab

Gene Symbol

Gprc5b

Ensembl Gene

ENSMUSG00000008734

Gene Name

G protein-coupled receptor, family C, group 5, member B

Synonyms

hypothetical protein, clone 2-63

MMRRC Submission

041086-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R4298 (G1)

Quality Score

170

Status

Validated

Chromosome

Chromosomal Location

118972047-118995211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118984214 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 144 (A144V)

Ref Sequence

ENSEMBL: ENSMUSP00000146777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000208394]

Predicted Effect

probably benign
Transcript: ENSMUST00000008878
AA Change: A144V

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734
AA Change: A144V

Domain	Start	End	E-Value	Type
Pfam:7tm_3	67	294	2e-33	PFAM
low complexity region	360	371	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208394
AA Change: A144V

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)

Meta Mutation Damage Score

0.0728

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The encoded protein may modulate insulin secretion and increased protein expression is associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit partial neonatal and postnatal lethality, altered spontaneous activity pattern, and decreased response to a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Ebf3	C	T	7: 137,225,229	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr1263	A	T	2: 90,015,649	T240S	probably benign	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,401,827	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Gprc5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01106:Gprc5b	APN	7	118983861	missense	probably benign
IGL01687:Gprc5b	APN	7	118983986	missense	possibly damaging	0.67
IGL02937:Gprc5b	APN	7	118983794	missense	probably benign	0.36
IGL03088:Gprc5b	APN	7	118983633	missense	probably benign	0.08
IGL03106:Gprc5b	APN	7	118984193	missense	probably damaging	1.00
IGL03166:Gprc5b	APN	7	118983999	missense	probably benign	0.20
R0189:Gprc5b	UTSW	7	118983633	missense	probably benign	0.08
R0588:Gprc5b	UTSW	7	118983995	missense	probably benign
R1563:Gprc5b	UTSW	7	118983761	missense	probably benign	0.22
R2126:Gprc5b	UTSW	7	118984175	missense	probably damaging	1.00
R2842:Gprc5b	UTSW	7	118984079	missense	possibly damaging	0.93
R3153:Gprc5b	UTSW	7	118976547	missense	probably damaging	1.00
R3802:Gprc5b	UTSW	7	118983720	missense	possibly damaging	0.92
R3978:Gprc5b	UTSW	7	118984131	missense	probably damaging	1.00
R4007:Gprc5b	UTSW	7	118984214	missense	possibly damaging	0.55
R4183:Gprc5b	UTSW	7	118984526	missense	probably benign	0.03
R4297:Gprc5b	UTSW	7	118984214	missense	possibly damaging	0.55
R4299:Gprc5b	UTSW	7	118984214	missense	possibly damaging	0.55
R5286:Gprc5b	UTSW	7	118983687	missense	possibly damaging	0.93
R6492:Gprc5b	UTSW	7	118984577	missense	possibly damaging	0.68
R6606:Gprc5b	UTSW	7	118984073	missense	probably benign	0.00
R7085:Gprc5b	UTSW	7	118983632	missense	probably damaging	0.97
R7312:Gprc5b	UTSW	7	118984259	missense	probably damaging	1.00
R7593:Gprc5b	UTSW	7	118984269	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAATCCATGGGCTCGTAGGC -3'
(R):5'- CCTGATCACACTGCTTCTGATG -3'

Sequencing Primer
(F):5'- CGCAGGCTGGCTTCGTG -3'
(R):5'- TCCTAGTGAGACTACCCTTCATCAAG -3'

Posted On

2015-06-20