Incidental Mutation 'R4298:Gprc5b'
ID 323427
Institutional Source Beutler Lab
Gene Symbol Gprc5b
Ensembl Gene ENSMUSG00000008734
Gene Name G protein-coupled receptor, family C, group 5, member B
Synonyms hypothetical protein, clone 2-63
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock # R4298 (G1)
Quality Score 170
Status Validated
Chromosome 7
Chromosomal Location 118972047-118995211 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118984214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 144 (A144V)
Ref Sequence ENSEMBL: ENSMUSP00000146777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000208394]
AlphaFold Q923Z0
Predicted Effect probably benign
Transcript: ENSMUST00000008878
AA Change: A144V

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734
AA Change: A144V

DomainStartEndE-ValueType
Pfam:7tm_3 67 294 2e-33 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208394
AA Change: A144V

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The encoded protein may modulate insulin secretion and increased protein expression is associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit partial neonatal and postnatal lethality, altered spontaneous activity pattern, and decreased response to a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Gprc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Gprc5b APN 7 118983861 missense probably benign
IGL01687:Gprc5b APN 7 118983986 missense possibly damaging 0.67
IGL02937:Gprc5b APN 7 118983794 missense probably benign 0.36
IGL03088:Gprc5b APN 7 118983633 missense probably benign 0.08
IGL03106:Gprc5b APN 7 118984193 missense probably damaging 1.00
IGL03166:Gprc5b APN 7 118983999 missense probably benign 0.20
R0189:Gprc5b UTSW 7 118983633 missense probably benign 0.08
R0588:Gprc5b UTSW 7 118983995 missense probably benign
R1563:Gprc5b UTSW 7 118983761 missense probably benign 0.22
R2126:Gprc5b UTSW 7 118984175 missense probably damaging 1.00
R2842:Gprc5b UTSW 7 118984079 missense possibly damaging 0.93
R3153:Gprc5b UTSW 7 118976547 missense probably damaging 1.00
R3802:Gprc5b UTSW 7 118983720 missense possibly damaging 0.92
R3978:Gprc5b UTSW 7 118984131 missense probably damaging 1.00
R4007:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4183:Gprc5b UTSW 7 118984526 missense probably benign 0.03
R4297:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4299:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R5286:Gprc5b UTSW 7 118983687 missense possibly damaging 0.93
R6492:Gprc5b UTSW 7 118984577 missense possibly damaging 0.68
R6606:Gprc5b UTSW 7 118984073 missense probably benign 0.00
R7085:Gprc5b UTSW 7 118983632 missense probably damaging 0.97
R7312:Gprc5b UTSW 7 118984259 missense probably damaging 1.00
R7593:Gprc5b UTSW 7 118984269 missense probably damaging 1.00
R9180:Gprc5b UTSW 7 118984319 missense probably damaging 1.00
R9383:Gprc5b UTSW 7 118976538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATCCATGGGCTCGTAGGC -3'
(R):5'- CCTGATCACACTGCTTCTGATG -3'

Sequencing Primer
(F):5'- CGCAGGCTGGCTTCGTG -3'
(R):5'- TCCTAGTGAGACTACCCTTCATCAAG -3'
Posted On 2015-06-20