Incidental Mutation 'R4298:Ebf3'
ID323428
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137225229 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 318 (R318Q)
Ref Sequence ENSEMBL: ENSMUSP00000147829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000209578] [ENSMUST00000210774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033378
AA Change: R309Q

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: R309Q

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106118
AA Change: R309Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: R309Q

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168203
AA Change: R309Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: R309Q

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169486
AA Change: R309Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: R309Q

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209578
AA Change: R102Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209905
Predicted Effect possibly damaging
Transcript: ENSMUST00000210774
AA Change: R318Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7578:Ebf3 UTSW 7 137313532 missense probably damaging 1.00
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCATGCCAATGGTCCTCAC -3'
(R):5'- AAGAACCATAGGCCCAGAGTGTC -3'

Sequencing Primer
(F):5'- AATGGTCCTCACGCCTCAC -3'
(R):5'- CTGGGTGACAGGAGGGAACATTC -3'
Posted On2015-06-20