Mutagenetix > Incidental Mutations

Incidental Mutation 'R4298:Ebf3'

323428

Institutional Source

Beutler Lab

Gene Symbol

Ebf3

Ensembl Gene

ENSMUSG00000010476

Gene Name

early B cell factor 3

Synonyms

Olf-1/EBF-like 2, O/E-2, 3110018A08Rik

MMRRC Submission

041086-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137193673-137314445 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 137225229 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 318 (R318Q)

Ref Sequence

ENSEMBL: ENSMUSP00000147829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000209578] [ENSMUST00000210774]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033378
AA Change: R309Q

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: R309Q

Domain	Start	End	E-Value	Type
low complexity region	94	106	N/A	INTRINSIC
IPT	253	337	2.09e-7	SMART
HLH	338	387	1.43e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106118
AA Change: R309Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: R309Q

Domain	Start	End	E-Value	Type
Pfam:COE1_DBD	17	247	2.6e-151	PFAM
IPT	262	346	2.09e-7	SMART
HLH	347	396	1.43e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168203
AA Change: R309Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: R309Q

Domain	Start	End	E-Value	Type
low complexity region	94	106	N/A	INTRINSIC
IPT	253	337	2.09e-7	SMART
HLH	338	387	1.43e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169486
AA Change: R309Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: R309Q

Domain	Start	End	E-Value	Type
low complexity region	94	106	N/A	INTRINSIC
IPT	253	337	2.09e-7	SMART
HLH	338	387	1.43e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209578
AA Change: R102Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209905

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210774
AA Change: R318Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr1263	A	T	2: 90,015,649	T240S	probably benign	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,401,827	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Ebf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01081:Ebf3	APN	7	137225896	splice site	probably benign
IGL01938:Ebf3	APN	7	137309318	missense	probably damaging	1.00
IGL02076:Ebf3	APN	7	137231301	missense	possibly damaging	0.61
IGL02260:Ebf3	APN	7	137206190	missense	probably damaging	1.00
IGL02303:Ebf3	APN	7	137309365	missense	probably benign	0.01
IGL02828:Ebf3	APN	7	137307518	missense	probably damaging	0.98
IGL03211:Ebf3	APN	7	137231304	missense	probably benign	0.21
R0885:Ebf3	UTSW	7	137225884	missense	probably benign	0.10
R0962:Ebf3	UTSW	7	137225203	missense	probably damaging	0.99
R1166:Ebf3	UTSW	7	137313167	splice site	probably benign
R1255:Ebf3	UTSW	7	137225212	missense	probably benign	0.35
R1804:Ebf3	UTSW	7	137200521	missense	possibly damaging	0.89
R4393:Ebf3	UTSW	7	137225157	missense	probably damaging	0.99
R5061:Ebf3	UTSW	7	137313559	missense	possibly damaging	0.57
R5880:Ebf3	UTSW	7	137198638	missense	probably benign	0.04
R6024:Ebf3	UTSW	7	137200535	missense	probably damaging	1.00
R6109:Ebf3	UTSW	7	137206226	missense	probably damaging	1.00
R6634:Ebf3	UTSW	7	137201160	missense	probably damaging	0.99
R6958:Ebf3	UTSW	7	137199265	missense	possibly damaging	0.66
R6997:Ebf3	UTSW	7	137225265	missense	probably damaging	0.97
R7578:Ebf3	UTSW	7	137313532	missense	probably damaging	1.00
R7771:Ebf3	UTSW	7	137309363	missense	probably damaging	1.00
RF022:Ebf3	UTSW	7	137313942	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCATGCCAATGGTCCTCAC -3'
(R):5'- AAGAACCATAGGCCCAGAGTGTC -3'

Sequencing Primer
(F):5'- AATGGTCCTCACGCCTCAC -3'
(R):5'- CTGGGTGACAGGAGGGAACATTC -3'

Posted On

2015-06-20