Incidental Mutation 'R4298:Fbxw16'
ID323432
Institutional Source Beutler Lab
Gene Symbol Fbxw16
Ensembl Gene ENSMUSG00000074062
Gene NameF-box and WD-40 domain protein 16
Synonyms
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109432316-109449140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109446557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000082051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084984]
Predicted Effect probably benign
Transcript: ENSMUST00000084984
AA Change: I135V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082051
Gene: ENSMUSG00000074062
AA Change: I135V

DomainStartEndE-ValueType
FBOX 5 45 2.72e-6 SMART
SCOP:d1e1aa_ 128 249 3e-5 SMART
Blast:WD40 137 176 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197559
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Fbxw16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Fbxw16 APN 9 109436686 missense probably benign 0.34
IGL02801:Fbxw16 APN 9 109441076 missense possibly damaging 0.73
milky_way UTSW 9 109441250 missense probably damaging 1.00
R0041:Fbxw16 UTSW 9 109448164 missense probably damaging 1.00
R0245:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R0389:Fbxw16 UTSW 9 109432482 missense probably benign 0.03
R0652:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R1693:Fbxw16 UTSW 9 109436259 missense possibly damaging 0.74
R1772:Fbxw16 UTSW 9 109439582 missense possibly damaging 0.91
R1965:Fbxw16 UTSW 9 109441221 missense probably damaging 1.00
R2190:Fbxw16 UTSW 9 109436671 missense probably damaging 1.00
R2334:Fbxw16 UTSW 9 109438361 missense probably benign 0.16
R3800:Fbxw16 UTSW 9 109436597 missense probably damaging 0.99
R3976:Fbxw16 UTSW 9 109439629 missense probably benign 0.42
R4914:Fbxw16 UTSW 9 109438177 missense probably benign 0.01
R4948:Fbxw16 UTSW 9 109438347 missense probably damaging 1.00
R4995:Fbxw16 UTSW 9 109441250 missense probably damaging 1.00
R5057:Fbxw16 UTSW 9 109441164 missense probably damaging 1.00
R5077:Fbxw16 UTSW 9 109441049 critical splice donor site probably null
R5111:Fbxw16 UTSW 9 109436728 missense probably benign 0.11
R5294:Fbxw16 UTSW 9 109436644 missense probably benign 0.34
R5901:Fbxw16 UTSW 9 109441217 missense probably benign 0.06
R6295:Fbxw16 UTSW 9 109448769 intron probably benign
R6303:Fbxw16 UTSW 9 109449101 missense probably benign 0.00
R6664:Fbxw16 UTSW 9 109438258 missense probably benign 0.27
R6670:Fbxw16 UTSW 9 109438212 missense probably damaging 1.00
R6890:Fbxw16 UTSW 9 109436742 missense probably benign 0.14
R7056:Fbxw16 UTSW 9 109436284 missense possibly damaging 0.50
R7073:Fbxw16 UTSW 9 109441055 missense probably damaging 1.00
R7344:Fbxw16 UTSW 9 109449035 missense probably benign 0.00
R7396:Fbxw16 UTSW 9 109449023 missense probably damaging 1.00
R7464:Fbxw16 UTSW 9 109439551 missense possibly damaging 0.50
R7568:Fbxw16 UTSW 9 109439589 missense possibly damaging 0.49
R7735:Fbxw16 UTSW 9 109441067 missense probably damaging 1.00
R7808:Fbxw16 UTSW 9 109448154 missense probably damaging 0.96
R7998:Fbxw16 UTSW 9 109436698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGGCCCTGTACAGTTG -3'
(R):5'- ACCTCCTTCAGTTAGAGTTGTC -3'

Sequencing Primer
(F):5'- CAGAGGACTAGAGTTCTATGCCC -3'
(R):5'- TGTCCCTCAACTGTCTTGTG -3'
Posted On2015-06-20