Incidental Mutation 'R4298:Nefh'
ID323434
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Nameneurofilament, heavy polypeptide
SynonymsNF-H, NEFH, NF200
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4938754-4948064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4940066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 851 (I851T)
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
Predicted Effect probably benign
Transcript: ENSMUST00000093369
AA Change: I851T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396
AA Change: I851T

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4941356 missense possibly damaging 0.71
IGL03025:Nefh APN 11 4945289 missense probably damaging 0.99
FR4340:Nefh UTSW 11 4941033 small insertion probably benign
FR4340:Nefh UTSW 11 4941038 small insertion probably benign
FR4340:Nefh UTSW 11 4941040 small insertion probably benign
R0041:Nefh UTSW 11 4945184 missense possibly damaging 0.92
R0149:Nefh UTSW 11 4940799 missense probably benign 0.39
R0361:Nefh UTSW 11 4940799 missense probably benign 0.39
R0531:Nefh UTSW 11 4940240 missense probably damaging 1.00
R1340:Nefh UTSW 11 4941002 small insertion probably benign
R1349:Nefh UTSW 11 4941010 small insertion probably benign
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1564:Nefh UTSW 11 4939878 missense unknown
R2165:Nefh UTSW 11 4943872 missense probably damaging 1.00
R2417:Nefh UTSW 11 4939479 missense unknown
R2906:Nefh UTSW 11 4940216 missense probably benign 0.15
R3750:Nefh UTSW 11 4939937 missense probably benign 0.33
R4462:Nefh UTSW 11 4941015 missense probably damaging 0.98
R4713:Nefh UTSW 11 4939656 missense unknown
R4878:Nefh UTSW 11 4941333 missense probably damaging 0.98
R5423:Nefh UTSW 11 4940985 missense possibly damaging 0.59
R5648:Nefh UTSW 11 4945233 missense probably damaging 1.00
R5893:Nefh UTSW 11 4941323 missense probably damaging 1.00
R6459:Nefh UTSW 11 4939551 missense unknown
R7583:Nefh UTSW 11 4941089 missense probably damaging 0.96
R8557:Nefh UTSW 11 4941233 missense probably damaging 0.98
RF001:Nefh UTSW 11 4941030 small insertion probably benign
RF002:Nefh UTSW 11 4941047 small insertion probably benign
RF002:Nefh UTSW 11 4941050 small insertion probably benign
RF009:Nefh UTSW 11 4940997 small insertion probably benign
RF012:Nefh UTSW 11 4941030 small insertion probably benign
RF012:Nefh UTSW 11 4941032 small insertion probably benign
RF012:Nefh UTSW 11 4941055 small insertion probably benign
RF013:Nefh UTSW 11 4941032 small insertion probably benign
RF016:Nefh UTSW 11 4941022 small insertion probably benign
RF016:Nefh UTSW 11 4941023 small insertion probably benign
RF025:Nefh UTSW 11 4941003 small insertion probably benign
RF025:Nefh UTSW 11 4941029 small insertion probably benign
RF028:Nefh UTSW 11 4941012 small insertion probably benign
RF028:Nefh UTSW 11 4941029 small insertion probably benign
RF033:Nefh UTSW 11 4941029 frame shift probably null
RF033:Nefh UTSW 11 4941039 small insertion probably benign
RF035:Nefh UTSW 11 4941039 small insertion probably benign
RF036:Nefh UTSW 11 4941010 small insertion probably benign
RF036:Nefh UTSW 11 4941016 small insertion probably benign
RF036:Nefh UTSW 11 4941036 small insertion probably benign
RF036:Nefh UTSW 11 4941048 small insertion probably benign
RF037:Nefh UTSW 11 4940999 small insertion probably benign
RF037:Nefh UTSW 11 4941046 small insertion probably benign
RF037:Nefh UTSW 11 4941054 small insertion probably benign
RF038:Nefh UTSW 11 4941012 small insertion probably benign
RF038:Nefh UTSW 11 4941018 small insertion probably benign
RF038:Nefh UTSW 11 4941019 small insertion probably benign
RF038:Nefh UTSW 11 4941027 small insertion probably benign
RF038:Nefh UTSW 11 4941029 small insertion probably benign
RF038:Nefh UTSW 11 4941040 small insertion probably benign
RF039:Nefh UTSW 11 4941007 small insertion probably benign
RF041:Nefh UTSW 11 4941039 small insertion probably benign
RF043:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941021 small insertion probably benign
RF044:Nefh UTSW 11 4941023 small insertion probably benign
RF047:Nefh UTSW 11 4941038 small insertion probably benign
RF048:Nefh UTSW 11 4941003 small insertion probably benign
RF048:Nefh UTSW 11 4941007 small insertion probably benign
RF049:Nefh UTSW 11 4940997 small insertion probably benign
RF051:Nefh UTSW 11 4941054 small insertion probably benign
RF053:Nefh UTSW 11 4941014 nonsense probably null
RF054:Nefh UTSW 11 4941048 small insertion probably benign
RF055:Nefh UTSW 11 4941004 small insertion probably benign
RF058:Nefh UTSW 11 4941021 small insertion probably benign
RF060:Nefh UTSW 11 4941050 small insertion probably benign
RF060:Nefh UTSW 11 4941052 small insertion probably benign
RF062:Nefh UTSW 11 4941028 small insertion probably benign
T0975:Nefh UTSW 11 4940151 missense probably benign 0.00
Z1186:Nefh UTSW 11 4940530 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTCCTTGGGCTTTTCCG -3'
(R):5'- AGGCCAAGTCTCCTGAGAAG -3'

Sequencing Primer
(F):5'- TCCACCTTGGGCTTCGG -3'
(R):5'- AGTCTCCTGAGAAGGCCAAGTC -3'
Posted On2015-06-20