Incidental Mutation 'R4298:Rack1'
ID323435
Institutional Source Beutler Lab
Gene Symbol Rack1
Ensembl Gene ENSMUSG00000020372
Gene Namereceptor for activated C kinase 1
SynonymsGnb2-rs1, GB-like, p205, Gnb2l1
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location48800332-48806434 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 48801626 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020640] [ENSMUST00000047145]
Predicted Effect probably benign
Transcript: ENSMUST00000020640
SMART Domains Protein: ENSMUSP00000020640
Gene: ENSMUSG00000020372

DomainStartEndE-ValueType
WD40 4 44 5.55e-7 SMART
WD40 52 91 6.48e-8 SMART
WD40 94 133 2.95e-11 SMART
WD40 135 178 8.55e-8 SMART
WD40 181 220 2.42e-7 SMART
WD40 223 260 6.34e-2 SMART
WD40 271 311 2.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047145
SMART Domains Protein: ENSMUSP00000037055
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
RING 20 186 2.91e-6 SMART
BBOX 222 263 3.31e-10 SMART
coiled coil region 281 313 N/A INTRINSIC
coiled coil region 336 374 N/A INTRINSIC
PRY 430 482 2.04e-19 SMART
Pfam:SPRY 485 629 6.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142269
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Embryos homozygous for a hypomorphic allele lack early egg cylinders and die at gastrulation. Heterozygotes show a transient growth deficit, a white belly spot and hypopigmented tail and paws, while embryonic fibroblasts show a reduction in PMA- and insulin-stimulated translation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Rack1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02524:Rack1 APN 11 48803471 missense probably benign 0.14
IGL02673:Rack1 APN 11 48800530 missense probably benign 0.01
R0630:Rack1 UTSW 11 48803977 unclassified probably benign
R1465:Rack1 UTSW 11 48801759 missense probably damaging 0.97
R1465:Rack1 UTSW 11 48801759 missense probably damaging 0.97
R3824:Rack1 UTSW 11 48802304 missense probably benign
R3825:Rack1 UTSW 11 48802304 missense probably benign
R4885:Rack1 UTSW 11 48805636 missense probably damaging 1.00
R6935:Rack1 UTSW 11 48803495 missense probably damaging 0.97
R6997:Rack1 UTSW 11 48803925 missense probably damaging 1.00
R7015:Rack1 UTSW 11 48801765 missense probably benign 0.39
R8765:Rack1 UTSW 11 48803459 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GTGGAACTTAAGTCTCAATCCCAG -3'
(R):5'- AAGATTCCAAAGCAGCTACTTGC -3'

Sequencing Primer
(F):5'- TCTCAATCCCAGGAAGTGTGG -3'
(R):5'- CTACTTGCGTTGTGAGATCCCAG -3'
Posted On2015-06-20