Incidental Mutation 'R4298:Tnfrsf13b'
ID 323436
Institutional Source Beutler Lab
Gene Symbol Tnfrsf13b
Ensembl Gene ENSMUSG00000010142
Gene Name tumor necrosis factor receptor superfamily, member 13b
Synonyms Taci, 1200009E08Rik
MMRRC Submission 041086-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4298 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 61017581-61040198 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 61031643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010286] [ENSMUST00000010286] [ENSMUST00000010286] [ENSMUST00000010286] [ENSMUST00000101103] [ENSMUST00000139422] [ENSMUST00000139422] [ENSMUST00000139422] [ENSMUST00000139422] [ENSMUST00000146033] [ENSMUST00000146033] [ENSMUST00000146033] [ENSMUST00000146033]
AlphaFold Q9ET35
Predicted Effect probably null
Transcript: ENSMUST00000010286
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000010286
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000010286
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000010286
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101103
SMART Domains Protein: ENSMUSP00000098662
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 81 2.6e-33 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137832
Predicted Effect probably null
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146033
Predicted Effect probably null
Transcript: ENSMUST00000146033
Predicted Effect probably null
Transcript: ENSMUST00000146033
Predicted Effect probably null
Transcript: ENSMUST00000146033
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show increased B cell numbers and splenomegaly. Homozygotes for a null allele show impaired T cell-independent immune responses and isotype switching. Homozygotes for another null allele develop lymphoproliferation and fatal autoimmune nephritis with high titers of autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 87,258,154 (GRCm39) probably null Het
Ccser2 T A 14: 36,612,337 (GRCm39) Q158L possibly damaging Het
Cct7 T A 6: 85,445,155 (GRCm39) C469S probably damaging Het
Chmp7 A T 14: 69,956,650 (GRCm39) probably null Het
Clcn4 C T 7: 7,299,737 (GRCm39) D31N possibly damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Ctdp1 A T 18: 80,493,172 (GRCm39) V441E probably benign Het
Cyp4a10 T C 4: 115,389,889 (GRCm39) L498P probably damaging Het
Dsc3 A T 18: 20,113,811 (GRCm39) N370K possibly damaging Het
Dusp12 G A 1: 170,708,198 (GRCm39) T173M probably benign Het
Ebf3 C T 7: 136,826,958 (GRCm39) R318Q possibly damaging Het
Epcam T C 17: 87,947,962 (GRCm39) probably null Het
Erich6 G T 3: 58,531,712 (GRCm39) A428D probably benign Het
Ext1 A T 15: 53,208,521 (GRCm39) I80N probably benign Het
Extl1 T C 4: 134,084,969 (GRCm39) E667G probably damaging Het
F2 T G 2: 91,459,665 (GRCm39) probably null Het
Fbxw16 T C 9: 109,275,625 (GRCm39) I135V probably benign Het
Glipr1l1 A T 10: 111,898,252 (GRCm39) D119V probably benign Het
Gprc5b G A 7: 118,583,437 (GRCm39) A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,882 (GRCm39) R252H possibly damaging Het
Lyst A G 13: 13,809,472 (GRCm39) T381A probably damaging Het
Mcpt4 A T 14: 56,298,444 (GRCm39) V97D possibly damaging Het
Nefh A G 11: 4,890,066 (GRCm39) I851T probably benign Het
Nf1 A T 11: 79,275,070 (GRCm39) I44F probably damaging Het
Nyap2 A T 1: 81,218,811 (GRCm39) I278F probably damaging Het
Or4c52 A T 2: 89,845,993 (GRCm39) T240S probably benign Het
Or4f7d-ps1 G T 2: 111,674,789 (GRCm39) noncoding transcript Het
Pdcd4 C A 19: 53,908,092 (GRCm39) P201Q probably damaging Het
Pramel16 A T 4: 143,675,713 (GRCm39) L371* probably null Het
Prdm11 T C 2: 92,823,728 (GRCm39) T179A probably benign Het
Qrfpr T A 3: 36,243,703 (GRCm39) I133F probably damaging Het
Rack1 T C 11: 48,692,453 (GRCm39) probably benign Het
Reln A C 5: 22,125,485 (GRCm39) C2733G probably damaging Het
Rrs1 C T 1: 9,616,448 (GRCm39) R234C possibly damaging Het
Sag G C 1: 87,772,737 (GRCm39) D402H probably benign Het
Sbk3 T A 7: 4,972,979 (GRCm39) T64S probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Sh3gl1 C T 17: 56,326,173 (GRCm39) G111D probably damaging Het
Spata20 G A 11: 94,373,914 (GRCm39) R379W probably damaging Het
St3gal2 T C 8: 111,688,991 (GRCm39) M177T probably benign Het
Stk39 C T 2: 68,221,284 (GRCm39) G213D probably damaging Het
Szt2 A G 4: 118,222,603 (GRCm39) probably benign Het
Taf1d T C 9: 15,219,939 (GRCm39) S63P probably damaging Het
Ttn G T 2: 76,554,394 (GRCm39) A30807D probably damaging Het
Unc119 A G 11: 78,238,948 (GRCm39) N158S probably damaging Het
Vmn2r116 T A 17: 23,620,801 (GRCm39) I845N possibly damaging Het
Vmn2r12 C A 5: 109,239,830 (GRCm39) M244I probably benign Het
Zdhhc4 A G 5: 143,309,997 (GRCm39) V87A probably damaging Het
Zwilch A G 9: 64,062,444 (GRCm39) probably null Het
Other mutations in Tnfrsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Tnfrsf13b APN 11 61,032,146 (GRCm39) missense possibly damaging 0.51
R0523:Tnfrsf13b UTSW 11 61,038,413 (GRCm39) missense probably benign 0.33
R2297:Tnfrsf13b UTSW 11 61,038,271 (GRCm39) missense probably benign
R2517:Tnfrsf13b UTSW 11 61,032,302 (GRCm39) missense probably benign 0.27
R4299:Tnfrsf13b UTSW 11 61,031,643 (GRCm39) splice site probably null
R4454:Tnfrsf13b UTSW 11 61,032,264 (GRCm39) missense probably benign 0.33
R4931:Tnfrsf13b UTSW 11 61,031,763 (GRCm39) missense possibly damaging 0.66
R5416:Tnfrsf13b UTSW 11 61,037,849 (GRCm39) splice site probably null
R7995:Tnfrsf13b UTSW 11 61,031,742 (GRCm39) nonsense probably null
R8531:Tnfrsf13b UTSW 11 61,031,777 (GRCm39) critical splice donor site probably null
R8790:Tnfrsf13b UTSW 11 61,038,350 (GRCm39) missense possibly damaging 0.53
R8858:Tnfrsf13b UTSW 11 61,038,363 (GRCm39) missense possibly damaging 0.73
RF013:Tnfrsf13b UTSW 11 61,032,270 (GRCm39) missense probably benign
Z1176:Tnfrsf13b UTSW 11 61,037,836 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACCTGGTACACATGGAGGAC -3'
(R):5'- ATTCCAGAATGGTTGGGCCC -3'

Sequencing Primer
(F):5'- CTGGTACACATGGAGGACAATGTG -3'
(R):5'- TCTATATATTCAGAAAGGCCAGGG -3'
Posted On 2015-06-20