Incidental Mutation 'R4298:Unc119'
ID323437
Institutional Source Beutler Lab
Gene Symbol Unc119
Ensembl Gene ENSMUSG00000002058
Gene Nameunc-119 lipid binding chaperone
SynonymsUNC119, Unc119h, MRG4, HRG4, Rtg4, Rg4
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78343482-78349164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78348122 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 158 (N158S)
Ref Sequence ENSEMBL: ENSMUSP00000103930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000100755] [ENSMUST00000108295]
Predicted Effect probably benign
Transcript: ENSMUST00000002127
AA Change: N158S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058
AA Change: N158S

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100755
AA Change: N93S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098318
Gene: ENSMUSG00000002058
AA Change: N93S

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 13 172 1.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108295
AA Change: N158S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058
AA Change: N158S

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155471
Meta Mutation Damage Score 0.1217 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: The protein encoded by this gene is multifunctional, affecting trafficking of transducin in rod photoreceptors, interacting with src-type tyrosine kinases through SH2 and SH3 interacting domains, and aiding the uptake of bacteria through endocytosis. In addition, the encoded protein acts as a lipid-binding chaperone to help localize some myristoylated proteins correctly. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit retinal degeneration characterized by thinning of the outer nuclear layer of the retinal that is visible at 6 months and progresses rapidly after 17 to end-stage by 26 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Unc119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Unc119 APN 11 78348609 missense probably damaging 1.00
IGL01317:Unc119 APN 11 78347226 missense probably damaging 0.99
IGL03164:Unc119 APN 11 78348176 missense probably damaging 1.00
R2166:Unc119 UTSW 11 78347335 splice site probably null
R5584:Unc119 UTSW 11 78348570 missense probably damaging 1.00
R6594:Unc119 UTSW 11 78347220 missense probably damaging 1.00
R7001:Unc119 UTSW 11 78348554 missense probably damaging 0.99
R7322:Unc119 UTSW 11 78348623 missense probably damaging 1.00
R7401:Unc119 UTSW 11 78347245 missense probably benign 0.00
R7675:Unc119 UTSW 11 78343597 missense probably damaging 1.00
R8700:Unc119 UTSW 11 78347311 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCGCTACCAGTTCACACCTG -3'
(R):5'- AGCAGCTTGGGTTCTACACATC -3'

Sequencing Primer
(F):5'- ACGTGAGTCACTGGGCTG -3'
(R):5'- GGGTTCTACACATCCCCCAC -3'
Posted On2015-06-20