Incidental Mutation 'R4298:Ccser2'
ID323440
Institutional Source Beutler Lab
Gene Symbol Ccser2
Ensembl Gene ENSMUSG00000058690
Gene Namecoiled-coil serine rich 2
Synonyms1700012P13Rik, 2900054P12Rik, Gcap14
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location36874936-36968777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36890380 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 158 (Q158L)
Ref Sequence ENSEMBL: ENSMUSP00000138100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067700] [ENSMUST00000090024] [ENSMUST00000182042] [ENSMUST00000182576] [ENSMUST00000182797] [ENSMUST00000183007] [ENSMUST00000183038] [ENSMUST00000183316]
Predicted Effect probably benign
Transcript: ENSMUST00000067700
SMART Domains Protein: ENSMUSP00000068550
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090024
AA Change: Q790L

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087478
Gene: ENSMUSG00000058690
AA Change: Q790L

DomainStartEndE-ValueType
low complexity region 389 412 N/A INTRINSIC
low complexity region 496 506 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 603 616 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 710 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182042
AA Change: Q218L

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138453
Gene: ENSMUSG00000058690
AA Change: Q218L

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182558
Predicted Effect probably benign
Transcript: ENSMUST00000182576
SMART Domains Protein: ENSMUSP00000138318
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182797
AA Change: Q218L

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138787
Gene: ENSMUSG00000058690
AA Change: Q218L

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183007
Predicted Effect probably benign
Transcript: ENSMUST00000183038
SMART Domains Protein: ENSMUSP00000138718
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183316
AA Change: Q158L

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138100
Gene: ENSMUSG00000058690
AA Change: Q158L

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
coiled coil region 78 115 N/A INTRINSIC
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Ccser2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ccser2 APN 14 36940064 missense probably damaging 1.00
IGL01285:Ccser2 APN 14 36938669 missense probably damaging 1.00
IGL01622:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL01623:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL02322:Ccser2 APN 14 36909129 missense probably damaging 1.00
IGL02342:Ccser2 APN 14 36918605 splice site probably benign
IGL02899:Ccser2 APN 14 36940759 missense probably benign 0.39
R0433:Ccser2 UTSW 14 36918529 missense probably damaging 1.00
R0543:Ccser2 UTSW 14 36940192 missense probably benign
R0674:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R0853:Ccser2 UTSW 14 36940410 missense probably benign 0.18
R0964:Ccser2 UTSW 14 36909008 splice site probably benign
R1748:Ccser2 UTSW 14 36896313 missense probably damaging 1.00
R1748:Ccser2 UTSW 14 36896314 nonsense probably null
R1854:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R2405:Ccser2 UTSW 14 36938669 missense probably damaging 1.00
R2926:Ccser2 UTSW 14 36879561 missense possibly damaging 0.91
R3846:Ccser2 UTSW 14 36940288 missense probably benign
R4701:Ccser2 UTSW 14 36938697 missense probably damaging 1.00
R4746:Ccser2 UTSW 14 36909125 missense probably damaging 1.00
R4888:Ccser2 UTSW 14 36940386 missense probably damaging 0.98
R4959:Ccser2 UTSW 14 36940796 missense probably benign 0.00
R5020:Ccser2 UTSW 14 36940177 missense probably benign 0.00
R5179:Ccser2 UTSW 14 36879351 missense possibly damaging 0.79
R5378:Ccser2 UTSW 14 36879434 missense possibly damaging 0.65
R6011:Ccser2 UTSW 14 36879575 missense probably benign 0.17
R6057:Ccser2 UTSW 14 36941165 missense probably damaging 0.98
R6180:Ccser2 UTSW 14 36940319 missense probably benign
R6216:Ccser2 UTSW 14 36940508 missense probably damaging 1.00
R6244:Ccser2 UTSW 14 36940718 missense probably benign 0.00
R6266:Ccser2 UTSW 14 36879675 missense probably damaging 1.00
R6730:Ccser2 UTSW 14 36879086 missense probably damaging 1.00
R6862:Ccser2 UTSW 14 36940081 missense probably benign
R7025:Ccser2 UTSW 14 36940007 missense probably damaging 1.00
R7076:Ccser2 UTSW 14 36939829 missense probably benign 0.14
R7092:Ccser2 UTSW 14 36940655 missense probably benign 0.03
R7353:Ccser2 UTSW 14 36941143 missense possibly damaging 0.91
R7440:Ccser2 UTSW 14 36898217 missense possibly damaging 0.92
R7509:Ccser2 UTSW 14 36938645 missense probably damaging 1.00
R7555:Ccser2 UTSW 14 36879500 missense possibly damaging 0.65
R7770:Ccser2 UTSW 14 36926874 missense probably damaging 1.00
X0066:Ccser2 UTSW 14 36940999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGCATGCAGTCAGGGAAAG -3'
(R):5'- CCTAGGAAGAGGTGTAGAGTTCTG -3'

Sequencing Primer
(F):5'- CATGCAGTCAGGGAAAGGTTAG -3'
(R):5'- CTGATGTATTATTAGTTTGAGCTGCC -3'
Posted On2015-06-20