Incidental Mutation 'R4298:Vmn2r116'
ID323445
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Namevomeronasal 2, receptor 116
SynonymsV2Rp5, EG619697
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23384803-23401864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23401827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 845 (I845N)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164856
AA Change: I845N

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: I845N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 synonymous probably null
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGCTTCACTCTGGCTTTC -3'
(R):5'- GTCAATGGAAATATCAGCAGACATG -3'

Sequencing Primer
(F):5'- CCATAACATTCAGCATGCTGGTG -3'
(R):5'- CAGCAGACATGTTATTGCTAGGC -3'
Posted On2015-06-20