Mutagenetix > Incidental Mutation

Incidental Mutation 'R4298:Vmn2r116'

323445

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

MMRRC Submission

041086-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23401827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 845 (I845N)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

AlphaFold

E9Q6I0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164856
AA Change: I845N

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: I845N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,449,957	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Ebf3	C	T	7: 137,225,229	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr1263	A	T	2: 90,015,649	T240S	probably benign	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0015:Vmn2r116	UTSW	17	23401849	missense	probably benign	0.03
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R0843:Vmn2r116	UTSW	17	23400960	missense	probably benign	0.01
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5807:Vmn2r116	UTSW	17	23387307	missense	probably damaging	1.00
R5837:Vmn2r116	UTSW	17	23387080	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
R8950:Vmn2r116	UTSW	17	23401493	missense	probably damaging	1.00
R8956:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R8977:Vmn2r116	UTSW	17	23386942	missense	possibly damaging	0.56
R9030:Vmn2r116	UTSW	17	23384890	missense	possibly damaging	0.82
R9077:Vmn2r116	UTSW	17	23385982	missense	probably benign	0.14
R9223:Vmn2r116	UTSW	17	23401167	missense	probably damaging	1.00
R9401:Vmn2r116	UTSW	17	23401592	missense	probably damaging	1.00
R9449:Vmn2r116	UTSW	17	23386945	missense	probably benign	0.01
R9746:Vmn2r116	UTSW	17	23401823	missense	probably benign	0.08
R9755:Vmn2r116	UTSW	17	23401091	missense	probably damaging	1.00
R9759:Vmn2r116	UTSW	17	23401386	missense	possibly damaging	0.90
R9800:Vmn2r116	UTSW	17	23401425	missense	probably damaging	0.97
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGCTTCACTCTGGCTTTC -3'
(R):5'- GTCAATGGAAATATCAGCAGACATG -3'

Sequencing Primer
(F):5'- CCATAACATTCAGCATGCTGGTG -3'
(R):5'- CAGCAGACATGTTATTGCTAGGC -3'

Posted On

2015-06-20