Incidental Mutation 'R4298:Epcam'
ID323447
Institutional Source Beutler Lab
Gene Symbol Epcam
Ensembl Gene ENSMUSG00000045394
Gene Nameepithelial cell adhesion molecule
SynonymsGA733-2, Egp314, EpCAM, gp40, Ly74, EGP-2, CD326, panepithelial glycoprotein 314, TROP1, Ep-CAM, EpCAM1, Tacstd1
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location87635979-87651106 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 87640534 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053577] [ENSMUST00000053577]
Predicted Effect probably null
Transcript: ENSMUST00000053577
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053577
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with decreased embryo size, impaired labyrinth layer development and decreased number of trophoblast giant cells. Mice homozygous for another knock-out allele exhibit impaired intestinal tight junctions with lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Epcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02739:Epcam APN 17 87640494 missense probably benign 0.30
R0664:Epcam UTSW 17 87639970 missense possibly damaging 0.86
R1612:Epcam UTSW 17 87639938 missense possibly damaging 0.87
R1693:Epcam UTSW 17 87639896 missense probably benign
R1719:Epcam UTSW 17 87642128 missense probably damaging 1.00
R1998:Epcam UTSW 17 87640474 missense probably damaging 1.00
R3872:Epcam UTSW 17 87639926 missense possibly damaging 0.79
R4297:Epcam UTSW 17 87640534 splice site probably null
R4866:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R4900:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R5091:Epcam UTSW 17 87642152 missense probably damaging 1.00
R5301:Epcam UTSW 17 87636877 missense possibly damaging 0.92
R6207:Epcam UTSW 17 87640436 missense probably damaging 1.00
R7576:Epcam UTSW 17 87640293 missense probably damaging 1.00
R7751:Epcam UTSW 17 87640476 nonsense probably null
R7795:Epcam UTSW 17 87643555 missense probably benign 0.08
R8022:Epcam UTSW 17 87646308 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAATGCTTGGCGATGAAAGC -3'
(R):5'- GGATGGACACTTGTCACTCC -3'

Sequencing Primer
(F):5'- TTGGCGATGAAAGCAGAAATGACTC -3'
(R):5'- TGGACACTTGTCACTCCAAAAGGG -3'
Posted On2015-06-20