Incidental Mutation 'R4298:Ctdp1'
ID 323449
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene Name CTD phosphatase subunit 1
Synonyms 4930563P03Rik
MMRRC Submission 041086-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R4298 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 80451174-80512910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80493172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 441 (V441E)
Ref Sequence ENSEMBL: ENSMUSP00000038938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229]
AlphaFold Q7TSG2
Predicted Effect probably benign
Transcript: ENSMUST00000036229
AA Change: V441E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: V441E

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 87,258,154 (GRCm39) probably null Het
Ccser2 T A 14: 36,612,337 (GRCm39) Q158L possibly damaging Het
Cct7 T A 6: 85,445,155 (GRCm39) C469S probably damaging Het
Chmp7 A T 14: 69,956,650 (GRCm39) probably null Het
Clcn4 C T 7: 7,299,737 (GRCm39) D31N possibly damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cyp4a10 T C 4: 115,389,889 (GRCm39) L498P probably damaging Het
Dsc3 A T 18: 20,113,811 (GRCm39) N370K possibly damaging Het
Dusp12 G A 1: 170,708,198 (GRCm39) T173M probably benign Het
Ebf3 C T 7: 136,826,958 (GRCm39) R318Q possibly damaging Het
Epcam T C 17: 87,947,962 (GRCm39) probably null Het
Erich6 G T 3: 58,531,712 (GRCm39) A428D probably benign Het
Ext1 A T 15: 53,208,521 (GRCm39) I80N probably benign Het
Extl1 T C 4: 134,084,969 (GRCm39) E667G probably damaging Het
F2 T G 2: 91,459,665 (GRCm39) probably null Het
Fbxw16 T C 9: 109,275,625 (GRCm39) I135V probably benign Het
Glipr1l1 A T 10: 111,898,252 (GRCm39) D119V probably benign Het
Gprc5b G A 7: 118,583,437 (GRCm39) A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,882 (GRCm39) R252H possibly damaging Het
Lyst A G 13: 13,809,472 (GRCm39) T381A probably damaging Het
Mcpt4 A T 14: 56,298,444 (GRCm39) V97D possibly damaging Het
Nefh A G 11: 4,890,066 (GRCm39) I851T probably benign Het
Nf1 A T 11: 79,275,070 (GRCm39) I44F probably damaging Het
Nyap2 A T 1: 81,218,811 (GRCm39) I278F probably damaging Het
Or4c52 A T 2: 89,845,993 (GRCm39) T240S probably benign Het
Or4f7d-ps1 G T 2: 111,674,789 (GRCm39) noncoding transcript Het
Pdcd4 C A 19: 53,908,092 (GRCm39) P201Q probably damaging Het
Pramel16 A T 4: 143,675,713 (GRCm39) L371* probably null Het
Prdm11 T C 2: 92,823,728 (GRCm39) T179A probably benign Het
Qrfpr T A 3: 36,243,703 (GRCm39) I133F probably damaging Het
Rack1 T C 11: 48,692,453 (GRCm39) probably benign Het
Reln A C 5: 22,125,485 (GRCm39) C2733G probably damaging Het
Rrs1 C T 1: 9,616,448 (GRCm39) R234C possibly damaging Het
Sag G C 1: 87,772,737 (GRCm39) D402H probably benign Het
Sbk3 T A 7: 4,972,979 (GRCm39) T64S probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Sh3gl1 C T 17: 56,326,173 (GRCm39) G111D probably damaging Het
Spata20 G A 11: 94,373,914 (GRCm39) R379W probably damaging Het
St3gal2 T C 8: 111,688,991 (GRCm39) M177T probably benign Het
Stk39 C T 2: 68,221,284 (GRCm39) G213D probably damaging Het
Szt2 A G 4: 118,222,603 (GRCm39) probably benign Het
Taf1d T C 9: 15,219,939 (GRCm39) S63P probably damaging Het
Tnfrsf13b C G 11: 61,031,643 (GRCm39) probably null Het
Ttn G T 2: 76,554,394 (GRCm39) A30807D probably damaging Het
Unc119 A G 11: 78,238,948 (GRCm39) N158S probably damaging Het
Vmn2r116 T A 17: 23,620,801 (GRCm39) I845N possibly damaging Het
Vmn2r12 C A 5: 109,239,830 (GRCm39) M244I probably benign Het
Zdhhc4 A G 5: 143,309,997 (GRCm39) V87A probably damaging Het
Zwilch A G 9: 64,062,444 (GRCm39) probably null Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80,501,907 (GRCm39) splice site probably null
IGL01695:Ctdp1 APN 18 80,492,841 (GRCm39) missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80,499,199 (GRCm39) missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80,499,187 (GRCm39) missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80,463,799 (GRCm39) missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80,493,305 (GRCm39) missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80,493,400 (GRCm39) missense probably benign
IGL03117:Ctdp1 APN 18 80,492,716 (GRCm39) missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80,492,849 (GRCm39) nonsense probably null
IGL03385:Ctdp1 APN 18 80,493,133 (GRCm39) missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80,492,569 (GRCm39) missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80,490,637 (GRCm39) critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80,493,457 (GRCm39) missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80,512,736 (GRCm39) missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80,492,702 (GRCm39) missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80,493,428 (GRCm39) missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80,492,616 (GRCm39) missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80,492,696 (GRCm39) missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80,493,428 (GRCm39) nonsense probably null
R3724:Ctdp1 UTSW 18 80,502,482 (GRCm39) missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80,495,566 (GRCm39) missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80,493,172 (GRCm39) missense probably benign
R4640:Ctdp1 UTSW 18 80,494,369 (GRCm39) critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80,451,941 (GRCm39) missense unknown
R4842:Ctdp1 UTSW 18 80,451,941 (GRCm39) missense unknown
R5007:Ctdp1 UTSW 18 80,463,695 (GRCm39) missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80,499,303 (GRCm39) missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80,490,675 (GRCm39) missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80,451,901 (GRCm39) missense unknown
R5896:Ctdp1 UTSW 18 80,502,003 (GRCm39) missense probably damaging 1.00
R6242:Ctdp1 UTSW 18 80,502,427 (GRCm39) missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80,502,512 (GRCm39) critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80,502,455 (GRCm39) missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80,494,470 (GRCm39) missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80,463,689 (GRCm39) missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80,494,478 (GRCm39) missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80,492,766 (GRCm39) missense probably benign
R6802:Ctdp1 UTSW 18 80,463,656 (GRCm39) critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80,483,929 (GRCm39) splice site probably null
R8121:Ctdp1 UTSW 18 80,499,223 (GRCm39) missense probably damaging 1.00
R8348:Ctdp1 UTSW 18 80,493,325 (GRCm39) missense probably benign 0.00
R8350:Ctdp1 UTSW 18 80,512,494 (GRCm39) missense probably benign 0.03
R8513:Ctdp1 UTSW 18 80,492,678 (GRCm39) missense possibly damaging 0.49
R9140:Ctdp1 UTSW 18 80,484,043 (GRCm39) critical splice donor site probably null
R9339:Ctdp1 UTSW 18 80,492,689 (GRCm39) missense probably damaging 1.00
R9617:Ctdp1 UTSW 18 80,492,962 (GRCm39) missense probably benign
R9758:Ctdp1 UTSW 18 80,492,710 (GRCm39) missense probably damaging 1.00
R9762:Ctdp1 UTSW 18 80,492,550 (GRCm39) nonsense probably null
X0020:Ctdp1 UTSW 18 80,493,205 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGTCCAGGTCTGACCCTTTG -3'
(R):5'- TGGAACAAGCTCTCTCCGTG -3'

Sequencing Primer
(F):5'- ATGCTAGGCCCAGACTCTC -3'
(R):5'- AGCACAGCAATGGCCTTG -3'
Posted On 2015-06-20