Mutagenetix > Incidental Mutations

Incidental Mutation 'R4298:Ctdp1'

323449

Institutional Source

Beutler Lab

Gene Symbol

Ctdp1

Ensembl Gene

ENSMUSG00000033323

Gene Name

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1

Synonyms

4930563P03Rik

MMRRC Submission

041086-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80407959-80469695 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80449957 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 441 (V441E)

Ref Sequence

ENSEMBL: ENSMUSP00000038938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036229]

Predicted Effect

probably benign
Transcript: ENSMUST00000036229
AA Change: V441E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: V441E

Domain	Start	End	E-Value	Type
low complexity region	55	72	N/A	INTRINSIC
CPDc	181	327	1.21e-62	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
BRCT	621	708	9.62e-7	SMART
low complexity region	779	787	N/A	INTRINSIC
low complexity region	879	889	N/A	INTRINSIC
PDB:1ONV\|B	890	921	2e-6	PDB
coiled coil region	936	959	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,531,525		probably null	Het
Ccser2	T	A	14: 36,890,380	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,468,173	C469S	probably damaging	Het
Chmp7	A	T	14: 69,719,201		probably null	Het
Clcn4	C	T	7: 7,296,738	D31N	possibly damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cyp4a10	T	C	4: 115,532,692	L498P	probably damaging	Het
Dsc3	A	T	18: 19,980,754	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,880,629	T173M	probably benign	Het
Ebf3	C	T	7: 137,225,229	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,640,534		probably null	Het
Erich6	G	T	3: 58,624,291	A428D	probably benign	Het
Ext1	A	T	15: 53,345,125	I80N	probably benign	Het
Extl1	T	C	4: 134,357,658	E667G	probably damaging	Het
F2	T	G	2: 91,629,320		probably null	Het
Fbxw16	T	C	9: 109,446,557	I135V	probably benign	Het
Glipr1l1	A	T	10: 112,062,347	D119V	probably benign	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,795	R252H	possibly damaging	Het
Lyst	A	G	13: 13,634,887	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,060,987	V97D	possibly damaging	Het
Nefh	A	G	11: 4,940,066	I851T	probably benign	Het
Nf1	A	T	11: 79,384,244	I44F	probably damaging	Het
Nyap2	A	T	1: 81,241,096	I278F	probably damaging	Het
Olfr1263	A	T	2: 90,015,649	T240S	probably benign	Het
Olfr268-ps1	G	T	2: 111,844,444		noncoding transcript	Het
Pdcd4	C	A	19: 53,919,661	P201Q	probably damaging	Het
Pramef25	A	T	4: 143,949,143	L371*	probably null	Het
Prdm11	T	C	2: 92,993,383	T179A	probably benign	Het
Qrfpr	T	A	3: 36,189,554	I133F	probably damaging	Het
Rack1	T	C	11: 48,801,626		probably benign	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sag	G	C	1: 87,845,015	D402H	probably benign	Het
Sbk3	T	A	7: 4,969,980	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Sh3gl1	C	T	17: 56,019,173	G111D	probably damaging	Het
Spata20	G	A	11: 94,483,088	R379W	probably damaging	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stk39	C	T	2: 68,390,940	G213D	probably damaging	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Taf1d	T	C	9: 15,308,643	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Ttn	G	T	2: 76,724,050	A30807D	probably damaging	Het
Unc119	A	G	11: 78,348,122	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,401,827	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,324,242	V87A	probably damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Ctdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Ctdp1	APN	18	80458692	splice site	probably null
IGL01695:Ctdp1	APN	18	80449626	missense	probably damaging	1.00
IGL01865:Ctdp1	APN	18	80455984	missense	probably damaging	1.00
IGL02009:Ctdp1	APN	18	80455972	missense	probably damaging	1.00
IGL02419:Ctdp1	APN	18	80420584	missense	probably damaging	1.00
IGL02580:Ctdp1	APN	18	80450090	missense	probably benign	0.01
IGL02699:Ctdp1	APN	18	80450185	missense	probably benign
IGL03117:Ctdp1	APN	18	80449501	missense	probably damaging	0.98
IGL03301:Ctdp1	APN	18	80449634	nonsense	probably null
IGL03385:Ctdp1	APN	18	80449918	missense	probably damaging	1.00
R0370:Ctdp1	UTSW	18	80449354	missense	probably damaging	1.00
R0374:Ctdp1	UTSW	18	80447422	critical splice donor site	probably null
R0730:Ctdp1	UTSW	18	80450242	missense	probably benign	0.00
R0894:Ctdp1	UTSW	18	80469521	missense	probably benign	0.09
R1187:Ctdp1	UTSW	18	80449487	missense	probably damaging	1.00
R1437:Ctdp1	UTSW	18	80450213	missense	probably benign	0.01
R1988:Ctdp1	UTSW	18	80449401	missense	possibly damaging	0.89
R2192:Ctdp1	UTSW	18	80449481	missense	probably benign	0.30
R3709:Ctdp1	UTSW	18	80450213	nonsense	probably null
R3724:Ctdp1	UTSW	18	80459267	missense	probably benign	0.16
R3756:Ctdp1	UTSW	18	80452351	missense	probably damaging	0.98
R4297:Ctdp1	UTSW	18	80449957	missense	probably benign
R4640:Ctdp1	UTSW	18	80451154	critical splice donor site	probably null
R4841:Ctdp1	UTSW	18	80408726	missense	unknown
R4842:Ctdp1	UTSW	18	80408726	missense	unknown
R5007:Ctdp1	UTSW	18	80420480	missense	probably damaging	0.99
R5055:Ctdp1	UTSW	18	80456088	missense	probably damaging	1.00
R5219:Ctdp1	UTSW	18	80447460	missense	probably damaging	1.00
R5870:Ctdp1	UTSW	18	80408686	missense	unknown
R5896:Ctdp1	UTSW	18	80458788	missense	probably damaging	1.00
R6242:Ctdp1	UTSW	18	80459212	missense	probably damaging	1.00
R6255:Ctdp1	UTSW	18	80459297	critical splice acceptor site	probably null
R6300:Ctdp1	UTSW	18	80459240	missense	probably benign	0.26
R6431:Ctdp1	UTSW	18	80451255	missense	probably damaging	0.96
R6462:Ctdp1	UTSW	18	80420474	missense	probably damaging	0.98
R6512:Ctdp1	UTSW	18	80451263	missense	probably damaging	1.00
R6537:Ctdp1	UTSW	18	80449551	missense	probably benign
R6802:Ctdp1	UTSW	18	80420441	critical splice donor site	probably null
R7477:Ctdp1	UTSW	18	80440714	intron	probably null
X0020:Ctdp1	UTSW	18	80449990	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTGTCCAGGTCTGACCCTTTG -3'
(R):5'- TGGAACAAGCTCTCTCCGTG -3'

Sequencing Primer
(F):5'- ATGCTAGGCCCAGACTCTC -3'
(R):5'- AGCACAGCAATGGCCTTG -3'

Posted On

2015-06-20