Mutagenetix > Incidental Mutations

Incidental Mutation 'R4299:Madd'

323460

Institutional Source

Beutler Lab

Gene Symbol

Madd

Ensembl Gene

ENSMUSG00000040687

Gene Name

MAP-kinase activating death domain

Synonyms

Rab3 GEP, 9630059K23Rik

MMRRC Submission

041087-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91137360-91183837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91169803 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 197 (L197P)

Ref Sequence

ENSEMBL: ENSMUSP00000117657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066420
AA Change: L586P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066473
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075269
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	762	770	N/A	INTRINSIC
low complexity region	797	820	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	1276	1290	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000077941
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1354	1368	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099723
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1189	1203	N/A	INTRINSIC
low complexity region	1353	1367	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099725
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111369
AA Change: L586P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	865	875	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111370
AA Change: L586P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1334	1348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111371
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	762	770	N/A	INTRINSIC
low complexity region	797	820	N/A	INTRINSIC
low complexity region	909	919	N/A	INTRINSIC
low complexity region	1296	1310	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111372
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1295	1309	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111373
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	2.9e-29	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	8.7e-71	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	2.8e-16	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	865	875	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111375
AA Change: L586P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	773	796	N/A	INTRINSIC
low complexity region	885	895	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111376
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	721	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	908	918	N/A	INTRINSIC
low complexity region	1151	1162	N/A	INTRINSIC
low complexity region	1312	1326	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111381
AA Change: L586P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: L586P

Domain	Start	End	E-Value	Type
uDENN	7	97	7.11e-26	SMART
low complexity region	124	139	N/A	INTRINSIC
DENN	171	401	2.19e-67	SMART
low complexity region	412	428	N/A	INTRINSIC
dDENN	484	554	6.71e-13	SMART
low complexity region	619	639	N/A	INTRINSIC
low complexity region	699	718	N/A	INTRINSIC
low complexity region	781	789	N/A	INTRINSIC
low complexity region	816	839	N/A	INTRINSIC
low complexity region	928	938	N/A	INTRINSIC
low complexity region	1315	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125227

Predicted Effect

probably damaging
Transcript: ENSMUST00000140600
AA Change: L197P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687
AA Change: L197P

Domain	Start	End	E-Value	Type
Blast:DENN	1	28	7e-10	BLAST
low complexity region	39	55	N/A	INTRINSIC
dDENN	111	165	9.37e-1	SMART
low complexity region	230	250	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125321

Meta Mutation Damage Score

0.9214

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,526	R208G	possibly damaging	Het
Abcc12	T	C	8: 86,531,525		probably null	Het
Akna	A	T	4: 63,398,032	D31E	possibly damaging	Het
Apbb2	A	T	5: 66,313,378	H528Q	probably damaging	Het
Atp6v1g3	C	A	1: 138,283,724	Y47*	probably null	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
BC048403	C	A	10: 121,745,446	H117Q	probably benign	Het
C4b	T	C	17: 34,731,144	D1384G	possibly damaging	Het
C87499	T	C	4: 88,628,182	K137E	probably damaging	Het
Cbfa2t2	G	A	2: 154,523,928	V353I	probably damaging	Het
Cdh7	T	C	1: 110,061,001	I211T	probably damaging	Het
Cep170b	T	C	12: 112,739,305	S1166P	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	G	A	16: 22,805,411	Q149*	probably null	Het
Cyp2c70	T	C	19: 40,183,928	Q90R	probably benign	Het
Cyp3a41b	T	C	5: 145,573,677	Y129C	possibly damaging	Het
Dnah10	A	G	5: 124,819,925	T3645A	probably damaging	Het
Dolk	A	T	2: 30,285,188	W282R	probably damaging	Het
Dsg2	T	A	18: 20,595,951		probably null	Het
Dysf	A	G	6: 84,068,077	T297A	possibly damaging	Het
Flt1	G	T	5: 147,683,907	D142E	probably benign	Het
Frmd4a	C	A	2: 4,333,071	N29K	probably benign	Het
Fxyd7	A	T	7: 31,044,982	M36K	probably benign	Het
Gabbr1	C	T	17: 37,055,900	R178*	probably null	Het
Gm14139	G	A	2: 150,190,733	D17N	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Il1rapl1	A	T	X: 87,300,707	I194N	probably damaging	Het
Klhl24	T	C	16: 20,107,004	M94T	probably damaging	Het
Kmt2e	T	A	5: 23,464,914	I133N	probably damaging	Het
Macf1	A	G	4: 123,399,406	I5381T	probably damaging	Het
Mapkapk3	G	A	9: 107,257,449	T296M	probably damaging	Het
Micall2	T	C	5: 139,709,471		probably benign	Het
Myh9	T	C	15: 77,769,964	T1214A	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Neurl4	A	C	11: 69,909,061	D1055A	probably damaging	Het
Nrbp1	T	C	5: 31,250,599		probably null	Het
Olfr1052	A	T	2: 86,298,241	I142F	possibly damaging	Het
Olfr27	T	C	9: 39,144,999	S300P	probably benign	Het
Olfr380	A	T	11: 73,454,001	D70E	probably damaging	Het
Olfr421-ps1	T	A	1: 174,152,312	Y265*	probably null	Het
Olfr53	T	C	7: 140,652,243	V88A	probably benign	Het
Olfr67	T	A	7: 103,787,995	H94L	probably benign	Het
Olfr901	T	G	9: 38,430,812	Y177D	probably damaging	Het
Olfr933	T	A	9: 38,975,759	F28I	probably damaging	Het
Patj	C	A	4: 98,677,321	N1090K	possibly damaging	Het
Pde8a	A	G	7: 81,328,035	D692G	probably benign	Het
Ppa2	G	T	3: 133,367,842	K220N	probably damaging	Het
Rad54b	A	G	4: 11,597,865	H250R	probably damaging	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rgs14	A	G	13: 55,383,753	T497A	probably damaging	Het
Rpl13-ps3	T	A	14: 58,893,523		noncoding transcript	Het
Scn11a	T	G	9: 119,765,506	I1274L	probably damaging	Het
Sco1	A	T	11: 67,055,800	H133L	possibly damaging	Het
Slc4a8	T	C	15: 100,796,640		probably null	Het
Smc2	C	T	4: 52,440,238		probably benign	Het
Spata18	T	C	5: 73,666,902	I156T	probably benign	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stt3a	A	G	9: 36,763,344	F48L	probably damaging	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Telo2	A	T	17: 25,115,256	S6T	possibly damaging	Het
Tnfrsf11b	T	C	15: 54,252,095	M369V	probably benign	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Vmn1r234	A	T	17: 21,229,021	M66L	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Wdfy2	T	A	14: 62,925,140	L97*	probably null	Het
Wdr63	C	T	3: 146,068,806	D429N	probably damaging	Het
Xrcc5	T	C	1: 72,394,720	*733Q	probably null	Het
Zadh2	A	T	18: 84,094,501	I101F	possibly damaging	Het
Zfp516	G	A	18: 82,987,497	G842D	possibly damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Madd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Madd	APN	2	91175766	unclassified	probably benign
IGL00781:Madd	APN	2	91146928	missense	probably benign	0.00
IGL00844:Madd	APN	2	91167868	missense	probably damaging	1.00
IGL00942:Madd	APN	2	91170578	missense	probably damaging	1.00
IGL01100:Madd	APN	2	91158040	missense	probably damaging	1.00
IGL01116:Madd	APN	2	91154543	splice site	probably benign
IGL01694:Madd	APN	2	91157975	splice site	probably benign
IGL01982:Madd	APN	2	91175707	missense	probably damaging	1.00
IGL02346:Madd	APN	2	91162491	missense	probably damaging	0.97
IGL02354:Madd	APN	2	91162198	missense	probably benign	0.17
IGL02361:Madd	APN	2	91162198	missense	probably benign	0.17
IGL02481:Madd	APN	2	91178036	missense	probably damaging	1.00
IGL02483:Madd	APN	2	91178036	missense	probably damaging	1.00
IGL02948:Madd	APN	2	91142827	missense	probably benign
IGL03338:Madd	APN	2	91162162	missense	possibly damaging	0.48
BB005:Madd	UTSW	2	91176888	missense	probably damaging	1.00
BB015:Madd	UTSW	2	91176888	missense	probably damaging	1.00
R0026:Madd	UTSW	2	91175708	missense	possibly damaging	0.88
R0026:Madd	UTSW	2	91175708	missense	possibly damaging	0.88
R0027:Madd	UTSW	2	91152549	missense	probably damaging	0.97
R0085:Madd	UTSW	2	91162738	missense	probably benign	0.00
R0577:Madd	UTSW	2	91138395	missense	possibly damaging	0.88
R0587:Madd	UTSW	2	91146885	missense	probably damaging	1.00
R1112:Madd	UTSW	2	91143599	missense	probably damaging	1.00
R1722:Madd	UTSW	2	91167637	missense	probably benign
R1750:Madd	UTSW	2	91167891	missense	probably damaging	0.98
R2061:Madd	UTSW	2	91161486	intron	probably benign
R2112:Madd	UTSW	2	91176976	missense	possibly damaging	0.89
R2114:Madd	UTSW	2	91164022	missense	probably damaging	1.00
R2140:Madd	UTSW	2	91152509	missense	possibly damaging	0.80
R2276:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2277:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2279:Madd	UTSW	2	91143683	missense	possibly damaging	0.67
R2424:Madd	UTSW	2	91166622	missense	probably damaging	1.00
R2904:Madd	UTSW	2	91175672	missense	probably damaging	1.00
R3122:Madd	UTSW	2	91176209	missense	probably damaging	1.00
R3836:Madd	UTSW	2	91154643	critical splice donor site	probably null
R3979:Madd	UTSW	2	91176828	missense	possibly damaging	0.81
R4151:Madd	UTSW	2	91143083	missense	probably benign	0.11
R4233:Madd	UTSW	2	91178236	missense	probably benign	0.26
R4236:Madd	UTSW	2	91167028	missense	probably benign	0.00
R4334:Madd	UTSW	2	91140572	missense	probably benign	0.08
R4413:Madd	UTSW	2	91167587	missense	probably damaging	1.00
R4595:Madd	UTSW	2	91167664	missense	possibly damaging	0.80
R4694:Madd	UTSW	2	91160328	missense	probably damaging	0.99
R5410:Madd	UTSW	2	91154514	missense	probably damaging	1.00
R5490:Madd	UTSW	2	91170635	missense	possibly damaging	0.80
R5560:Madd	UTSW	2	91163545	missense	probably damaging	1.00
R5661:Madd	UTSW	2	91154433	critical splice donor site	probably null
R5710:Madd	UTSW	2	91154476	missense	probably damaging	1.00
R5730:Madd	UTSW	2	91158109	missense	probably damaging	1.00
R5759:Madd	UTSW	2	91162075	missense	possibly damaging	0.94
R5768:Madd	UTSW	2	91167829	missense	probably damaging	1.00
R5822:Madd	UTSW	2	91152533	missense	probably damaging	1.00
R6125:Madd	UTSW	2	91152452	critical splice donor site	probably null
R6151:Madd	UTSW	2	91165457	nonsense	probably null
R6229:Madd	UTSW	2	91143670	missense	probably damaging	0.96
R6230:Madd	UTSW	2	91143521	critical splice donor site	probably null
R6245:Madd	UTSW	2	91178104	missense	probably benign	0.27
R6323:Madd	UTSW	2	91161438	splice site	probably null
R6456:Madd	UTSW	2	91178191	missense	probably benign
R6473:Madd	UTSW	2	91167059	missense	probably benign
R6878:Madd	UTSW	2	91169857	missense	probably damaging	1.00
R7060:Madd	UTSW	2	91177107	missense	probably damaging	1.00
R7065:Madd	UTSW	2	91155057	missense	probably benign	0.26
R7073:Madd	UTSW	2	91162509	missense	probably damaging	1.00
R7124:Madd	UTSW	2	91162048	missense	possibly damaging	0.94
R7251:Madd	UTSW	2	91162176	missense	probably benign	0.01
R7510:Madd	UTSW	2	91177976	missense	possibly damaging	0.80
R7605:Madd	UTSW	2	91169710	missense	possibly damaging	0.90
R7911:Madd	UTSW	2	91167508	missense	probably null	0.01
R7928:Madd	UTSW	2	91176888	missense	probably damaging	1.00
R7952:Madd	UTSW	2	91162541	missense	probably damaging	1.00
R8039:Madd	UTSW	2	91167061	missense	probably benign	0.17
R8047:Madd	UTSW	2	91179201	missense	probably damaging	1.00
R8048:Madd	UTSW	2	91154448	missense	probably damaging	0.99
R8070:Madd	UTSW	2	91158014	nonsense	probably null
R8090:Madd	UTSW	2	91155623	missense	probably benign	0.01
R8335:Madd	UTSW	2	91170239	missense	probably damaging	1.00
R8459:Madd	UTSW	2	91162526	missense	probably benign
X0067:Madd	UTSW	2	91152473	missense	probably damaging	1.00
Z1176:Madd	UTSW	2	91159272	missense	probably damaging	0.96
Z1177:Madd	UTSW	2	91142831	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATGCAGAGCTTCCAAGACTC -3'
(R):5'- ATTCACAACAGTGAGTCCGC -3'

Sequencing Primer
(F):5'- TCACACCTACAACTGGTACGAG -3'
(R):5'- AACAGTGAGTCCGCCTGCC -3'

Posted On

2015-06-20