Mutagenetix > Incidental Mutations

Incidental Mutation 'R4299:Cbfa2t2'

323462

Institutional Source

Beutler Lab

Gene Symbol

Cbfa2t2

Ensembl Gene

ENSMUSG00000038533

Gene Name

core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)

Synonyms

Cbfa2t2h, MTGR1, C330013D05Rik

MMRRC Submission

041087-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.778) question?

Stock #

R4299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154436481-154539356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 154523928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 353 (V353I)

Ref Sequence

ENSEMBL: ENSMUSP00000096782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109725]

AlphaFold

O70374

Predicted Effect

probably damaging
Transcript: ENSMUST00000045270
AA Change: V353I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533
AA Change: V353I

Domain	Start	End	E-Value	Type
low complexity region	33	52	N/A	INTRINSIC
TAFH	106	196	1.06e-49	SMART
Pfam:NHR2	322	388	1.3e-40	PFAM
PDB:2KYG\|C	420	450	3e-7	PDB
Pfam:zf-MYND	498	534	1.4e-9	PFAM
low complexity region	573	588	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099178
AA Change: V353I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533
AA Change: V353I

Domain	Start	End	E-Value	Type
low complexity region	33	52	N/A	INTRINSIC
TAFH	106	196	1.06e-49	SMART
Pfam:NHR2	322	388	4.4e-40	PFAM
low complexity region	402	419	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109725
AA Change: V353I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533
AA Change: V353I

Domain	Start	End	E-Value	Type
low complexity region	33	52	N/A	INTRINSIC
TAFH	106	196	1.06e-49	SMART
Pfam:NHR2	322	388	1e-40	PFAM
Pfam:zf-MYND	497	533	3.3e-11	PFAM
low complexity region	572	587	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137526
AA Change: V58I

SMART Domains

Protein: ENSMUSP00000118371
Gene: ENSMUSG00000038533
AA Change: V58I

Domain	Start	End	E-Value	Type
low complexity region	11	20	N/A	INTRINSIC
Pfam:NHR2	28	94	2e-41	PFAM
Pfam:zf-MYND	203	239	3.1e-10	PFAM
low complexity region	278	293	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154487

Meta Mutation Damage Score

0.4133

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,526	R208G	possibly damaging	Het
Abcc12	T	C	8: 86,531,525		probably null	Het
Akna	A	T	4: 63,398,032	D31E	possibly damaging	Het
Apbb2	A	T	5: 66,313,378	H528Q	probably damaging	Het
Atp6v1g3	C	A	1: 138,283,724	Y47*	probably null	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
BC048403	C	A	10: 121,745,446	H117Q	probably benign	Het
C4b	T	C	17: 34,731,144	D1384G	possibly damaging	Het
C87499	T	C	4: 88,628,182	K137E	probably damaging	Het
Cdh7	T	C	1: 110,061,001	I211T	probably damaging	Het
Cep170b	T	C	12: 112,739,305	S1166P	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	G	A	16: 22,805,411	Q149*	probably null	Het
Cyp2c70	T	C	19: 40,183,928	Q90R	probably benign	Het
Cyp3a41b	T	C	5: 145,573,677	Y129C	possibly damaging	Het
Dnah10	A	G	5: 124,819,925	T3645A	probably damaging	Het
Dolk	A	T	2: 30,285,188	W282R	probably damaging	Het
Dsg2	T	A	18: 20,595,951		probably null	Het
Dysf	A	G	6: 84,068,077	T297A	possibly damaging	Het
Flt1	G	T	5: 147,683,907	D142E	probably benign	Het
Frmd4a	C	A	2: 4,333,071	N29K	probably benign	Het
Fxyd7	A	T	7: 31,044,982	M36K	probably benign	Het
Gabbr1	C	T	17: 37,055,900	R178*	probably null	Het
Gm14139	G	A	2: 150,190,733	D17N	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Il1rapl1	A	T	X: 87,300,707	I194N	probably damaging	Het
Klhl24	T	C	16: 20,107,004	M94T	probably damaging	Het
Kmt2e	T	A	5: 23,464,914	I133N	probably damaging	Het
Macf1	A	G	4: 123,399,406	I5381T	probably damaging	Het
Madd	A	G	2: 91,169,803	L197P	probably damaging	Het
Mapkapk3	G	A	9: 107,257,449	T296M	probably damaging	Het
Micall2	T	C	5: 139,709,471		probably benign	Het
Myh9	T	C	15: 77,769,964	T1214A	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Neurl4	A	C	11: 69,909,061	D1055A	probably damaging	Het
Nrbp1	T	C	5: 31,250,599		probably null	Het
Olfr1052	A	T	2: 86,298,241	I142F	possibly damaging	Het
Olfr27	T	C	9: 39,144,999	S300P	probably benign	Het
Olfr380	A	T	11: 73,454,001	D70E	probably damaging	Het
Olfr421-ps1	T	A	1: 174,152,312	Y265*	probably null	Het
Olfr53	T	C	7: 140,652,243	V88A	probably benign	Het
Olfr67	T	A	7: 103,787,995	H94L	probably benign	Het
Olfr901	T	G	9: 38,430,812	Y177D	probably damaging	Het
Olfr933	T	A	9: 38,975,759	F28I	probably damaging	Het
Patj	C	A	4: 98,677,321	N1090K	possibly damaging	Het
Pde8a	A	G	7: 81,328,035	D692G	probably benign	Het
Ppa2	G	T	3: 133,367,842	K220N	probably damaging	Het
Rad54b	A	G	4: 11,597,865	H250R	probably damaging	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rgs14	A	G	13: 55,383,753	T497A	probably damaging	Het
Rpl13-ps3	T	A	14: 58,893,523		noncoding transcript	Het
Scn11a	T	G	9: 119,765,506	I1274L	probably damaging	Het
Sco1	A	T	11: 67,055,800	H133L	possibly damaging	Het
Slc4a8	T	C	15: 100,796,640		probably null	Het
Smc2	C	T	4: 52,440,238		probably benign	Het
Spata18	T	C	5: 73,666,902	I156T	probably benign	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stt3a	A	G	9: 36,763,344	F48L	probably damaging	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Telo2	A	T	17: 25,115,256	S6T	possibly damaging	Het
Tnfrsf11b	T	C	15: 54,252,095	M369V	probably benign	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Vmn1r234	A	T	17: 21,229,021	M66L	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Wdfy2	T	A	14: 62,925,140	L97*	probably null	Het
Wdr63	C	T	3: 146,068,806	D429N	probably damaging	Het
Xrcc5	T	C	1: 72,394,720	*733Q	probably null	Het
Zadh2	A	T	18: 84,094,501	I101F	possibly damaging	Het
Zfp516	G	A	18: 82,987,497	G842D	possibly damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Cbfa2t2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cbfa2t2	APN	2	154528875	missense	probably damaging	1.00
IGL01913:Cbfa2t2	APN	2	154517773	missense	probably damaging	1.00
IGL02090:Cbfa2t2	APN	2	154531416	splice site	probably benign
IGL02850:Cbfa2t2	APN	2	154535170	missense	probably damaging	0.97
R0302:Cbfa2t2	UTSW	2	154534876	splice site	probably benign
R0356:Cbfa2t2	UTSW	2	154531349	missense	probably benign	0.03
R1218:Cbfa2t2	UTSW	2	154523919	missense	probably benign	0.43
R1571:Cbfa2t2	UTSW	2	154500427	missense	probably damaging	1.00
R1998:Cbfa2t2	UTSW	2	154504789	missense	probably damaging	1.00
R2016:Cbfa2t2	UTSW	2	154517807	missense	probably damaging	1.00
R2017:Cbfa2t2	UTSW	2	154517807	missense	probably damaging	1.00
R2056:Cbfa2t2	UTSW	2	154535157	missense	probably damaging	1.00
R3617:Cbfa2t2	UTSW	2	154436984	intron	probably benign
R4746:Cbfa2t2	UTSW	2	154523925	missense	possibly damaging	0.94
R4969:Cbfa2t2	UTSW	2	154523980	missense	probably damaging	1.00
R5058:Cbfa2t2	UTSW	2	154504745	missense	probably damaging	1.00
R5109:Cbfa2t2	UTSW	2	154531373	missense	probably damaging	1.00
R5381:Cbfa2t2	UTSW	2	154523929	missense	probably damaging	1.00
R5573:Cbfa2t2	UTSW	2	154436862	intron	probably benign
R5808:Cbfa2t2	UTSW	2	154517826	splice site	probably null
R5826:Cbfa2t2	UTSW	2	154500455	missense	possibly damaging	0.90
R5977:Cbfa2t2	UTSW	2	154517777	missense	probably damaging	1.00
R6052:Cbfa2t2	UTSW	2	154510581	missense	probably damaging	1.00
R6842:Cbfa2t2	UTSW	2	154524045	missense	probably benign	0.02
R6923:Cbfa2t2	UTSW	2	154534983	missense	probably damaging	1.00
R7269:Cbfa2t2	UTSW	2	154515975	missense	probably benign	0.37
R7318:Cbfa2t2	UTSW	2	154500454	missense	probably benign	0.01
R7622:Cbfa2t2	UTSW	2	154500445	missense	possibly damaging	0.90
R8030:Cbfa2t2	UTSW	2	154515896	missense	probably damaging	0.96
R8691:Cbfa2t2	UTSW	2	154500483	missense	possibly damaging	0.74
R8977:Cbfa2t2	UTSW	2	154500490	missense	probably benign	0.06
R9420:Cbfa2t2	UTSW	2	154510506	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGGTCTGTATAAGTAACAAAGTCT -3'
(R):5'- CCGTTGCTGAGAGAATCTGT -3'

Sequencing Primer
(F):5'- AGTACTGGCTCCTCTTGTAGAAGAC -3'
(R):5'- TGCTGAGAGAATCTGTACTCCCAG -3'

Posted On

2015-06-20