Mutagenetix > Incidental Mutation

Incidental Mutation 'R4299:Kmt2e'

323474

Institutional Source

Beutler Lab

Gene Symbol

Kmt2e

Ensembl Gene

ENSMUSG00000029004

Gene Name

lysine (K)-specific methyltransferase 2E

Synonyms

D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5

MMRRC Submission

041087-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23434441-23504235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23464914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 133 (I133N)

Ref Sequence

ENSEMBL: ENSMUSP00000110781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]

AlphaFold

Q3UG20

Predicted Effect

probably damaging
Transcript: ENSMUST00000094962
AA Change: I133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: I133N

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000115128
AA Change: I133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: I133N

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000196889
AA Change: I133N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: I133N

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	2.7e-10	SMART
Blast:SET	216	327	6e-61	BLAST
Blast:SET	328	377	3e-26	BLAST

Meta Mutation Damage Score

0.9203

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,526	R208G	possibly damaging	Het
Abcc12	T	C	8: 86,531,525		probably null	Het
Akna	A	T	4: 63,398,032	D31E	possibly damaging	Het
Apbb2	A	T	5: 66,313,378	H528Q	probably damaging	Het
Atp6v1g3	C	A	1: 138,283,724	Y47*	probably null	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
BC048403	C	A	10: 121,745,446	H117Q	probably benign	Het
C4b	T	C	17: 34,731,144	D1384G	possibly damaging	Het
C87499	T	C	4: 88,628,182	K137E	probably damaging	Het
Cbfa2t2	G	A	2: 154,523,928	V353I	probably damaging	Het
Cdh7	T	C	1: 110,061,001	I211T	probably damaging	Het
Cep170b	T	C	12: 112,739,305	S1166P	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	G	A	16: 22,805,411	Q149*	probably null	Het
Cyp2c70	T	C	19: 40,183,928	Q90R	probably benign	Het
Cyp3a41b	T	C	5: 145,573,677	Y129C	possibly damaging	Het
Dnah10	A	G	5: 124,819,925	T3645A	probably damaging	Het
Dolk	A	T	2: 30,285,188	W282R	probably damaging	Het
Dsg2	T	A	18: 20,595,951		probably null	Het
Dysf	A	G	6: 84,068,077	T297A	possibly damaging	Het
Flt1	G	T	5: 147,683,907	D142E	probably benign	Het
Frmd4a	C	A	2: 4,333,071	N29K	probably benign	Het
Fxyd7	A	T	7: 31,044,982	M36K	probably benign	Het
Gabbr1	C	T	17: 37,055,900	R178*	probably null	Het
Gm14139	G	A	2: 150,190,733	D17N	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Il1rapl1	A	T	X: 87,300,707	I194N	probably damaging	Het
Klhl24	T	C	16: 20,107,004	M94T	probably damaging	Het
Macf1	A	G	4: 123,399,406	I5381T	probably damaging	Het
Madd	A	G	2: 91,169,803	L197P	probably damaging	Het
Mapkapk3	G	A	9: 107,257,449	T296M	probably damaging	Het
Micall2	T	C	5: 139,709,471		probably benign	Het
Myh9	T	C	15: 77,769,964	T1214A	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Neurl4	A	C	11: 69,909,061	D1055A	probably damaging	Het
Nrbp1	T	C	5: 31,250,599		probably null	Het
Olfr1052	A	T	2: 86,298,241	I142F	possibly damaging	Het
Olfr27	T	C	9: 39,144,999	S300P	probably benign	Het
Olfr380	A	T	11: 73,454,001	D70E	probably damaging	Het
Olfr421-ps1	T	A	1: 174,152,312	Y265*	probably null	Het
Olfr53	T	C	7: 140,652,243	V88A	probably benign	Het
Olfr67	T	A	7: 103,787,995	H94L	probably benign	Het
Olfr901	T	G	9: 38,430,812	Y177D	probably damaging	Het
Olfr933	T	A	9: 38,975,759	F28I	probably damaging	Het
Patj	C	A	4: 98,677,321	N1090K	possibly damaging	Het
Pde8a	A	G	7: 81,328,035	D692G	probably benign	Het
Ppa2	G	T	3: 133,367,842	K220N	probably damaging	Het
Rad54b	A	G	4: 11,597,865	H250R	probably damaging	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rgs14	A	G	13: 55,383,753	T497A	probably damaging	Het
Rpl13-ps3	T	A	14: 58,893,523		noncoding transcript	Het
Scn11a	T	G	9: 119,765,506	I1274L	probably damaging	Het
Sco1	A	T	11: 67,055,800	H133L	possibly damaging	Het
Slc4a8	T	C	15: 100,796,640		probably null	Het
Smc2	C	T	4: 52,440,238		probably benign	Het
Spata18	T	C	5: 73,666,902	I156T	probably benign	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stt3a	A	G	9: 36,763,344	F48L	probably damaging	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Telo2	A	T	17: 25,115,256	S6T	possibly damaging	Het
Tnfrsf11b	T	C	15: 54,252,095	M369V	probably benign	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Vmn1r234	A	T	17: 21,229,021	M66L	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Wdfy2	T	A	14: 62,925,140	L97*	probably null	Het
Wdr63	C	T	3: 146,068,806	D429N	probably damaging	Het
Xrcc5	T	C	1: 72,394,720	*733Q	probably null	Het
Zadh2	A	T	18: 84,094,501	I101F	possibly damaging	Het
Zfp516	G	A	18: 82,987,497	G842D	possibly damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Kmt2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Kmt2e	APN	5	23492358	missense	probably damaging	0.99
IGL01330:Kmt2e	APN	5	23497948	missense	possibly damaging	0.95
IGL01457:Kmt2e	APN	5	23502019	missense	possibly damaging	0.62
IGL01691:Kmt2e	APN	5	23497091	missense	probably benign
IGL02274:Kmt2e	APN	5	23500760	missense	probably benign	0.00
IGL02934:Kmt2e	APN	5	23497884	missense	probably damaging	0.97
IGL02964:Kmt2e	APN	5	23467100	splice site	probably benign
IGL03011:Kmt2e	APN	5	23497542	missense	probably damaging	1.00
IGL03291:Kmt2e	APN	5	23499291	missense	probably damaging	1.00
R0035:Kmt2e	UTSW	5	23485621	splice site	probably benign
R0446:Kmt2e	UTSW	5	23497534	splice site	probably null
R0498:Kmt2e	UTSW	5	23478972	nonsense	probably null
R0699:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0701:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0761:Kmt2e	UTSW	5	23503034	nonsense	probably null
R1110:Kmt2e	UTSW	5	23502655	missense	probably damaging	1.00
R1295:Kmt2e	UTSW	5	23502404	missense	probably damaging	0.99
R1432:Kmt2e	UTSW	5	23450321	missense	probably benign	0.39
R1495:Kmt2e	UTSW	5	23499327	missense	possibly damaging	0.83
R1505:Kmt2e	UTSW	5	23500535	missense	probably null	0.01
R1623:Kmt2e	UTSW	5	23482502	missense	probably damaging	1.00
R1675:Kmt2e	UTSW	5	23482453	nonsense	probably null
R1691:Kmt2e	UTSW	5	23464849	missense	probably damaging	1.00
R1778:Kmt2e	UTSW	5	23492364	missense	probably damaging	1.00
R1820:Kmt2e	UTSW	5	23473547	missense	probably damaging	1.00
R1846:Kmt2e	UTSW	5	23499486	intron	probably benign
R1912:Kmt2e	UTSW	5	23492395	missense	probably benign	0.07
R2070:Kmt2e	UTSW	5	23501995	missense	probably benign
R2195:Kmt2e	UTSW	5	23502196	splice site	probably null
R2571:Kmt2e	UTSW	5	23501887	missense	probably benign	0.08
R3901:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3902:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3905:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3906:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3909:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3956:Kmt2e	UTSW	5	23496025	missense	probably benign	0.00
R4242:Kmt2e	UTSW	5	23502822	unclassified	probably benign
R4448:Kmt2e	UTSW	5	23464790	missense	possibly damaging	0.80
R4528:Kmt2e	UTSW	5	23473558	missense	possibly damaging	0.69
R4574:Kmt2e	UTSW	5	23492407	missense	possibly damaging	0.60
R4719:Kmt2e	UTSW	5	23492315	missense	probably damaging	1.00
R4754:Kmt2e	UTSW	5	23482441	missense	possibly damaging	0.88
R4787:Kmt2e	UTSW	5	23463083	missense	possibly damaging	0.65
R4812:Kmt2e	UTSW	5	23502587	missense	possibly damaging	0.86
R4853:Kmt2e	UTSW	5	23502341	missense	probably damaging	1.00
R5138:Kmt2e	UTSW	5	23502695	missense	probably damaging	0.99
R5306:Kmt2e	UTSW	5	23499333	missense	probably damaging	0.98
R5659:Kmt2e	UTSW	5	23497807	missense	probably damaging	0.99
R5907:Kmt2e	UTSW	5	23464706	missense	probably damaging	1.00
R5920:Kmt2e	UTSW	5	23499442	missense	possibly damaging	0.50
R6280:Kmt2e	UTSW	5	23499516	missense	possibly damaging	0.48
R6353:Kmt2e	UTSW	5	23493245	missense	probably damaging	1.00
R6375:Kmt2e	UTSW	5	23499519	missense	probably benign
R6553:Kmt2e	UTSW	5	23463026	missense	probably damaging	0.99
R6572:Kmt2e	UTSW	5	23497581	missense	possibly damaging	0.66
R6678:Kmt2e	UTSW	5	23499295	missense	possibly damaging	0.54
R6791:Kmt2e	UTSW	5	23499476	intron	probably benign
R6792:Kmt2e	UTSW	5	23499476	intron	probably benign
R6794:Kmt2e	UTSW	5	23499476	intron	probably benign
R6797:Kmt2e	UTSW	5	23482507	missense	possibly damaging	0.82
R6947:Kmt2e	UTSW	5	23497545	missense	probably damaging	1.00
R7023:Kmt2e	UTSW	5	23500487	missense	possibly damaging	0.46
R7036:Kmt2e	UTSW	5	23478743	missense	probably null	1.00
R7173:Kmt2e	UTSW	5	23464857	missense	probably damaging	1.00
R7202:Kmt2e	UTSW	5	23492294	unclassified	probably benign
R7563:Kmt2e	UTSW	5	23500273	missense	probably damaging	1.00
R7571:Kmt2e	UTSW	5	23478587	missense	probably damaging	1.00
R7604:Kmt2e	UTSW	5	23501765	missense	not run
R7722:Kmt2e	UTSW	5	23497018	missense	probably benign	0.00
R7758:Kmt2e	UTSW	5	23496070	missense	possibly damaging	0.92
R7794:Kmt2e	UTSW	5	23464716	missense	probably damaging	1.00
R8137:Kmt2e	UTSW	5	23501954	missense	probably damaging	1.00
R8341:Kmt2e	UTSW	5	23499453	missense	probably damaging	0.98
R8383:Kmt2e	UTSW	5	23485541	missense	probably benign	0.08
R8400:Kmt2e	UTSW	5	23497092	missense	probably benign	0.17
R8546:Kmt2e	UTSW	5	23481244	missense	probably damaging	1.00
R8750:Kmt2e	UTSW	5	23493217	missense	probably benign
R8786:Kmt2e	UTSW	5	23464866	missense	probably damaging	1.00
R9211:Kmt2e	UTSW	5	23464772	missense	possibly damaging	0.83
R9660:Kmt2e	UTSW	5	23478619	missense	probably damaging	1.00
R9786:Kmt2e	UTSW	5	23497984	missense	probably benign	0.16
RF026:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF028:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF040:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF042:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
Z1177:Kmt2e	UTSW	5	23481208	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AATTATGGTGCTCGTCCTCC -3'
(R):5'- CAAAAGTGACCTTACTACCATTTCC -3'

Sequencing Primer
(F):5'- GGTGCTCGTCCTCCTCCAAC -3'
(R):5'- CTTTAATCCTAAGCACTCGGGAGG -3'

Posted On

2015-06-20