Incidental Mutation 'R4299:Micall2'
ID 323481
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene Name MICAL-like 2
Synonyms MICAL-L2, Jrab, A930021H16Rik
MMRRC Submission 041087-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.352) question?
Stock # R4299 (G1)
Quality Score 137
Status Validated
Chromosome 5
Chromosomal Location 139692451-139722091 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 139695226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
AlphaFold Q3TN34
Predicted Effect probably benign
Transcript: ENSMUST00000044642
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718

DomainStartEndE-ValueType
CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164584
Predicted Effect probably benign
Transcript: ENSMUST00000165645
Predicted Effect probably benign
Transcript: ENSMUST00000170773
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718

DomainStartEndE-ValueType
SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 87,258,154 (GRCm39) probably null Het
Akna A T 4: 63,316,269 (GRCm39) D31E possibly damaging Het
Apbb2 A T 5: 66,470,721 (GRCm39) H528Q probably damaging Het
Atp6v1g3 C A 1: 138,211,462 (GRCm39) Y47* probably null Het
AW551984 T C 9: 39,504,275 (GRCm39) T564A probably benign Het
C4b T C 17: 34,950,118 (GRCm39) D1384G possibly damaging Het
Cbfa2t2 G A 2: 154,365,848 (GRCm39) V353I probably damaging Het
Ccdc121 A G 5: 31,644,870 (GRCm39) R208G possibly damaging Het
Cdh20 T C 1: 109,988,731 (GRCm39) I211T probably damaging Het
Cep170b T C 12: 112,705,739 (GRCm39) S1166P probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Crygs G A 16: 22,624,161 (GRCm39) Q149* probably null Het
Cyp2c70 T C 19: 40,172,372 (GRCm39) Q90R probably benign Het
Cyp3a41b T C 5: 145,510,487 (GRCm39) Y129C possibly damaging Het
Dnah10 A G 5: 124,896,989 (GRCm39) T3645A probably damaging Het
Dnai3 C T 3: 145,774,561 (GRCm39) D429N probably damaging Het
Dolk A T 2: 30,175,200 (GRCm39) W282R probably damaging Het
Dsg2 T A 18: 20,729,008 (GRCm39) probably null Het
Dysf A G 6: 84,045,059 (GRCm39) T297A possibly damaging Het
Flt1 G T 5: 147,620,717 (GRCm39) D142E probably benign Het
Frmd4a C A 2: 4,337,882 (GRCm39) N29K probably benign Het
Fxyd7 A T 7: 30,744,407 (GRCm39) M36K probably benign Het
Gabbr1 C T 17: 37,366,792 (GRCm39) R178* probably null Het
Gnal C G 18: 67,221,654 (GRCm39) P19R unknown Het
Gprc5b G A 7: 118,583,437 (GRCm39) A144V possibly damaging Het
Il1rapl1 A T X: 86,344,313 (GRCm39) I194N probably damaging Het
Kics2 C A 10: 121,581,351 (GRCm39) H117Q probably benign Het
Klhl24 T C 16: 19,925,754 (GRCm39) M94T probably damaging Het
Kmt2e T A 5: 23,669,912 (GRCm39) I133N probably damaging Het
Macf1 A G 4: 123,293,199 (GRCm39) I5381T probably damaging Het
Madd A G 2: 91,000,148 (GRCm39) L197P probably damaging Het
Mapkapk3 G A 9: 107,134,648 (GRCm39) T296M probably damaging Het
Myh9 T C 15: 77,654,164 (GRCm39) T1214A probably benign Het
Ncapd3 A G 9: 26,963,623 (GRCm39) N492S probably benign Het
Neurl4 A C 11: 69,799,887 (GRCm39) D1055A probably damaging Het
Nrbp1 T C 5: 31,407,943 (GRCm39) probably null Het
Or13a20 T C 7: 140,232,156 (GRCm39) V88A probably benign Het
Or1e21 A T 11: 73,344,827 (GRCm39) D70E probably damaging Het
Or52z1 T A 7: 103,437,202 (GRCm39) H94L probably benign Het
Or5j3 A T 2: 86,128,585 (GRCm39) I142F possibly damaging Het
Or6k8-ps1 T A 1: 173,979,878 (GRCm39) Y265* probably null Het
Or8b42 T G 9: 38,342,108 (GRCm39) Y177D probably damaging Het
Or8d1b T A 9: 38,887,055 (GRCm39) F28I probably damaging Het
Or8g19 T C 9: 39,056,295 (GRCm39) S300P probably benign Het
Patj C A 4: 98,565,558 (GRCm39) N1090K possibly damaging Het
Pde8a A G 7: 80,977,783 (GRCm39) D692G probably benign Het
Ppa2 G T 3: 133,073,603 (GRCm39) K220N probably damaging Het
Pramel32 T C 4: 88,546,419 (GRCm39) K137E probably damaging Het
Ptgr3 A T 18: 84,112,626 (GRCm39) I101F possibly damaging Het
Rad54b A G 4: 11,597,865 (GRCm39) H250R probably damaging Het
Reln A C 5: 22,125,485 (GRCm39) C2733G probably damaging Het
Rgs14 A G 13: 55,531,566 (GRCm39) T497A probably damaging Het
Rpl13-ps3 T A 14: 59,130,972 (GRCm39) noncoding transcript Het
Scn11a T G 9: 119,594,572 (GRCm39) I1274L probably damaging Het
Sco1 A T 11: 66,946,626 (GRCm39) H133L possibly damaging Het
Slc4a8 T C 15: 100,694,521 (GRCm39) probably null Het
Smc2 C T 4: 52,440,238 (GRCm39) probably benign Het
Spata18 T C 5: 73,824,245 (GRCm39) I156T probably benign Het
St3gal2 T C 8: 111,688,991 (GRCm39) M177T probably benign Het
Stt3a A G 9: 36,674,640 (GRCm39) F48L probably damaging Het
Syvn1 C T 19: 6,099,951 (GRCm39) probably benign Het
Szt2 A G 4: 118,222,603 (GRCm39) probably benign Het
Telo2 A T 17: 25,334,230 (GRCm39) S6T possibly damaging Het
Tnfrsf11b T C 15: 54,115,491 (GRCm39) M369V probably benign Het
Tnfrsf13b C G 11: 61,031,643 (GRCm39) probably null Het
Vmn1r234 A T 17: 21,449,283 (GRCm39) M66L probably benign Het
Vmn2r12 C A 5: 109,239,830 (GRCm39) M244I probably benign Het
Wdfy2 T A 14: 63,162,589 (GRCm39) L97* probably null Het
Xrcc5 T C 1: 72,433,879 (GRCm39) *733Q probably null Het
Zfp1004 G A 2: 150,032,653 (GRCm39) D17N probably damaging Het
Zfp516 G A 18: 83,005,622 (GRCm39) G842D possibly damaging Het
Zwilch A G 9: 64,062,444 (GRCm39) probably null Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139,703,311 (GRCm39) critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139,702,083 (GRCm39) missense probably benign 0.01
IGL02641:Micall2 APN 5 139,705,094 (GRCm39) missense probably damaging 1.00
IGL03245:Micall2 APN 5 139,705,014 (GRCm39) missense probably damaging 1.00
IGL03252:Micall2 APN 5 139,702,481 (GRCm39) missense probably benign 0.01
R1214:Micall2 UTSW 5 139,697,396 (GRCm39) missense probably damaging 0.97
R1468:Micall2 UTSW 5 139,705,097 (GRCm39) missense probably damaging 1.00
R1468:Micall2 UTSW 5 139,705,097 (GRCm39) missense probably damaging 1.00
R1831:Micall2 UTSW 5 139,702,508 (GRCm39) missense probably benign 0.09
R1833:Micall2 UTSW 5 139,702,508 (GRCm39) missense probably benign 0.09
R1969:Micall2 UTSW 5 139,721,885 (GRCm39) missense probably damaging 1.00
R2023:Micall2 UTSW 5 139,703,266 (GRCm39) missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139,697,317 (GRCm39) missense probably damaging 0.98
R2330:Micall2 UTSW 5 139,703,270 (GRCm39) missense probably damaging 1.00
R3820:Micall2 UTSW 5 139,701,611 (GRCm39) missense possibly damaging 0.92
R4334:Micall2 UTSW 5 139,699,105 (GRCm39) missense probably damaging 1.00
R4451:Micall2 UTSW 5 139,692,852 (GRCm39) missense probably damaging 1.00
R4769:Micall2 UTSW 5 139,692,641 (GRCm39) missense probably damaging 0.97
R4911:Micall2 UTSW 5 139,702,580 (GRCm39) missense probably damaging 1.00
R4996:Micall2 UTSW 5 139,696,344 (GRCm39) missense probably benign 0.31
R5118:Micall2 UTSW 5 139,702,202 (GRCm39) missense probably damaging 1.00
R5155:Micall2 UTSW 5 139,695,986 (GRCm39) missense probably damaging 1.00
R5475:Micall2 UTSW 5 139,702,224 (GRCm39) missense probably damaging 1.00
R5750:Micall2 UTSW 5 139,701,456 (GRCm39) splice site probably null
R5998:Micall2 UTSW 5 139,692,666 (GRCm39) critical splice acceptor site probably null
R6181:Micall2 UTSW 5 139,702,506 (GRCm39) missense probably benign 0.41
R6852:Micall2 UTSW 5 139,701,548 (GRCm39) missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139,694,699 (GRCm39) unclassified probably benign
R7395:Micall2 UTSW 5 139,702,124 (GRCm39) missense possibly damaging 0.78
R8514:Micall2 UTSW 5 139,701,977 (GRCm39) missense probably damaging 1.00
R8889:Micall2 UTSW 5 139,703,254 (GRCm39) missense probably damaging 0.98
R8892:Micall2 UTSW 5 139,703,254 (GRCm39) missense probably damaging 0.98
R8960:Micall2 UTSW 5 139,702,025 (GRCm39) missense probably benign 0.23
R9060:Micall2 UTSW 5 139,705,035 (GRCm39) missense probably damaging 1.00
R9209:Micall2 UTSW 5 139,696,170 (GRCm39) missense unknown
R9227:Micall2 UTSW 5 139,701,827 (GRCm39) missense unknown
R9230:Micall2 UTSW 5 139,701,827 (GRCm39) missense unknown
R9260:Micall2 UTSW 5 139,695,453 (GRCm39) missense unknown
R9452:Micall2 UTSW 5 139,703,311 (GRCm39) critical splice acceptor site probably null
Z1088:Micall2 UTSW 5 139,702,050 (GRCm39) missense probably benign 0.12
Z1088:Micall2 UTSW 5 139,692,649 (GRCm39) missense probably damaging 1.00
Z1177:Micall2 UTSW 5 139,696,057 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AATCTCACACTAGCTGTTGGGG -3'
(R):5'- TCATGTACAAGTGAGGACCCC -3'

Sequencing Primer
(F):5'- ACACTGTGAGGCCCTTACTTTGAAG -3'
(R):5'- TGTGCTACCCTGCCTGGAC -3'
Posted On 2015-06-20