Incidental Mutation 'R4299:Abcc12'
ID323491
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms4930467B22Rik, MRP9
MMRRC Submission 041087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4299 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location86482260-86580686 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 86531525 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000152438] [ENSMUST00000156610]
Predicted Effect probably null
Transcript: ENSMUST00000080115
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129898
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131423
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131423
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131806
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152438
SMART Domains Protein: ENSMUSP00000114582
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect silent
Transcript: ENSMUST00000156066
SMART Domains Protein: ENSMUSP00000120282
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:ABC_membrane 78 363 3.8e-35 PFAM
Pfam:ABC_tran 430 508 5.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156610
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,487,526 R208G possibly damaging Het
Akna A T 4: 63,398,032 D31E possibly damaging Het
Apbb2 A T 5: 66,313,378 H528Q probably damaging Het
Atp6v1g3 C A 1: 138,283,724 Y47* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
BC048403 C A 10: 121,745,446 H117Q probably benign Het
C4b T C 17: 34,731,144 D1384G possibly damaging Het
C87499 T C 4: 88,628,182 K137E probably damaging Het
Cbfa2t2 G A 2: 154,523,928 V353I probably damaging Het
Cdh7 T C 1: 110,061,001 I211T probably damaging Het
Cep170b T C 12: 112,739,305 S1166P probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs G A 16: 22,805,411 Q149* probably null Het
Cyp2c70 T C 19: 40,183,928 Q90R probably benign Het
Cyp3a41b T C 5: 145,573,677 Y129C possibly damaging Het
Dnah10 A G 5: 124,819,925 T3645A probably damaging Het
Dolk A T 2: 30,285,188 W282R probably damaging Het
Dsg2 T A 18: 20,595,951 probably null Het
Dysf A G 6: 84,068,077 T297A possibly damaging Het
Flt1 G T 5: 147,683,907 D142E probably benign Het
Frmd4a C A 2: 4,333,071 N29K probably benign Het
Fxyd7 A T 7: 31,044,982 M36K probably benign Het
Gabbr1 C T 17: 37,055,900 R178* probably null Het
Gm14139 G A 2: 150,190,733 D17N probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Il1rapl1 A T X: 87,300,707 I194N probably damaging Het
Klhl24 T C 16: 20,107,004 M94T probably damaging Het
Kmt2e T A 5: 23,464,914 I133N probably damaging Het
Macf1 A G 4: 123,399,406 I5381T probably damaging Het
Madd A G 2: 91,169,803 L197P probably damaging Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Micall2 T C 5: 139,709,471 probably benign Het
Myh9 T C 15: 77,769,964 T1214A probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Neurl4 A C 11: 69,909,061 D1055A probably damaging Het
Nrbp1 T C 5: 31,250,599 probably null Het
Olfr1052 A T 2: 86,298,241 I142F possibly damaging Het
Olfr27 T C 9: 39,144,999 S300P probably benign Het
Olfr380 A T 11: 73,454,001 D70E probably damaging Het
Olfr421-ps1 T A 1: 174,152,312 Y265* probably null Het
Olfr53 T C 7: 140,652,243 V88A probably benign Het
Olfr67 T A 7: 103,787,995 H94L probably benign Het
Olfr901 T G 9: 38,430,812 Y177D probably damaging Het
Olfr933 T A 9: 38,975,759 F28I probably damaging Het
Patj C A 4: 98,677,321 N1090K possibly damaging Het
Pde8a A G 7: 81,328,035 D692G probably benign Het
Ppa2 G T 3: 133,367,842 K220N probably damaging Het
Rad54b A G 4: 11,597,865 H250R probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rgs14 A G 13: 55,383,753 T497A probably damaging Het
Rpl13-ps3 T A 14: 58,893,523 noncoding transcript Het
Scn11a T G 9: 119,765,506 I1274L probably damaging Het
Sco1 A T 11: 67,055,800 H133L possibly damaging Het
Slc4a8 T C 15: 100,796,640 probably null Het
Smc2 C T 4: 52,440,238 probably benign Het
Spata18 T C 5: 73,666,902 I156T probably benign Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stt3a A G 9: 36,763,344 F48L probably damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Telo2 A T 17: 25,115,256 S6T possibly damaging Het
Tnfrsf11b T C 15: 54,252,095 M369V probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Vmn1r234 A T 17: 21,229,021 M66L probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Wdfy2 T A 14: 62,925,140 L97* probably null Het
Wdr63 C T 3: 146,068,806 D429N probably damaging Het
Xrcc5 T C 1: 72,394,720 *733Q probably null Het
Zadh2 A T 18: 84,094,501 I101F possibly damaging Het
Zfp516 G A 18: 82,987,497 G842D possibly damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 86534693 missense probably benign 0.45
IGL01504:Abcc12 APN 8 86557602 missense probably damaging 1.00
IGL01593:Abcc12 APN 8 86557650 missense probably damaging 1.00
IGL02164:Abcc12 APN 8 86527404 missense probably damaging 1.00
IGL02173:Abcc12 APN 8 86566442 missense probably damaging 1.00
IGL02175:Abcc12 APN 8 86535013 splice site probably null
IGL02405:Abcc12 APN 8 86558153 missense probably damaging 0.98
IGL02620:Abcc12 APN 8 86505314 splice site probably null
IGL02635:Abcc12 APN 8 86509682 splice site probably benign
IGL03241:Abcc12 APN 8 86509807 missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 86505246 missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0116:Abcc12 UTSW 8 86534998 missense probably benign 0.00
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0132:Abcc12 UTSW 8 86531568 missense probably benign
R0308:Abcc12 UTSW 8 86557752 splice site probably benign
R0589:Abcc12 UTSW 8 86560472 missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 86557693 missense probably damaging 1.00
R1564:Abcc12 UTSW 8 86517486 missense probably benign 0.10
R1740:Abcc12 UTSW 8 86505497 nonsense probably null
R1740:Abcc12 UTSW 8 86509771 missense possibly damaging 0.78
R1970:Abcc12 UTSW 8 86527281 missense probably benign 0.27
R2017:Abcc12 UTSW 8 86563988 missense probably damaging 1.00
R2026:Abcc12 UTSW 8 86558233 missense probably benign 0.30
R2402:Abcc12 UTSW 8 86509141 missense probably damaging 1.00
R3085:Abcc12 UTSW 8 86543907 splice site probably benign
R3115:Abcc12 UTSW 8 86540024 critical splice donor site probably null
R3176:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3276:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3847:Abcc12 UTSW 8 86553391 missense probably benign 0.05
R3911:Abcc12 UTSW 8 86528419 splice site probably benign
R4031:Abcc12 UTSW 8 86517448 missense probably damaging 1.00
R4297:Abcc12 UTSW 8 86531525 splice site probably null
R4298:Abcc12 UTSW 8 86531525 splice site probably null
R4688:Abcc12 UTSW 8 86548694 missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 86560842 missense probably damaging 1.00
R4863:Abcc12 UTSW 8 86538376 missense probably damaging 1.00
R4892:Abcc12 UTSW 8 86509802 missense probably benign 0.28
R5288:Abcc12 UTSW 8 86566539 missense probably damaging 1.00
R5303:Abcc12 UTSW 8 86509786 missense probably benign 0.15
R5332:Abcc12 UTSW 8 86524830 splice site probably null
R5386:Abcc12 UTSW 8 86517489 missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 86509844 missense probably benign 0.03
R5900:Abcc12 UTSW 8 86566520 missense possibly damaging 0.90
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6291:Abcc12 UTSW 8 86566544 missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 86509089
R6677:Abcc12 UTSW 8 86534752 missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 86560857 missense possibly damaging 0.94
R7411:Abcc12 UTSW 8 86560850 missense possibly damaging 0.95
R7619:Abcc12 UTSW 8 86566553 missense probably damaging 1.00
R7808:Abcc12 UTSW 8 86507939 missense probably benign 0.03
R7828:Abcc12 UTSW 8 86528275 missense probably benign 0.08
R7834:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7834:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
R7917:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7917:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
X0027:Abcc12 UTSW 8 86553291 missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 86560279 synonymous probably null
Z1176:Abcc12 UTSW 8 86550601 missense probably damaging 1.00
Z1177:Abcc12 UTSW 8 86527384 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGAACCTGGCAGCTTTAATGG -3'
(R):5'- CAAGGACCTTAGCAGTGGAG -3'

Sequencing Primer
(F):5'- CCATTTAAAGGGCTGTATTATCAGAC -3'
(R):5'- CCTTAGCAGTGGAGGGGAGC -3'
Posted On2015-06-20