Incidental Mutation 'R4299:Scn11a'
ID323500
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 041087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4299 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119765506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1274 (I1274L)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: I1274L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I1274L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: I1274L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.3871 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,487,526 R208G possibly damaging Het
Abcc12 T C 8: 86,531,525 probably null Het
Akna A T 4: 63,398,032 D31E possibly damaging Het
Apbb2 A T 5: 66,313,378 H528Q probably damaging Het
Atp6v1g3 C A 1: 138,283,724 Y47* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
BC048403 C A 10: 121,745,446 H117Q probably benign Het
C4b T C 17: 34,731,144 D1384G possibly damaging Het
C87499 T C 4: 88,628,182 K137E probably damaging Het
Cbfa2t2 G A 2: 154,523,928 V353I probably damaging Het
Cdh7 T C 1: 110,061,001 I211T probably damaging Het
Cep170b T C 12: 112,739,305 S1166P probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs G A 16: 22,805,411 Q149* probably null Het
Cyp2c70 T C 19: 40,183,928 Q90R probably benign Het
Cyp3a41b T C 5: 145,573,677 Y129C possibly damaging Het
Dnah10 A G 5: 124,819,925 T3645A probably damaging Het
Dolk A T 2: 30,285,188 W282R probably damaging Het
Dsg2 T A 18: 20,595,951 probably null Het
Dysf A G 6: 84,068,077 T297A possibly damaging Het
Flt1 G T 5: 147,683,907 D142E probably benign Het
Frmd4a C A 2: 4,333,071 N29K probably benign Het
Fxyd7 A T 7: 31,044,982 M36K probably benign Het
Gabbr1 C T 17: 37,055,900 R178* probably null Het
Gm14139 G A 2: 150,190,733 D17N probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Il1rapl1 A T X: 87,300,707 I194N probably damaging Het
Klhl24 T C 16: 20,107,004 M94T probably damaging Het
Kmt2e T A 5: 23,464,914 I133N probably damaging Het
Macf1 A G 4: 123,399,406 I5381T probably damaging Het
Madd A G 2: 91,169,803 L197P probably damaging Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Micall2 T C 5: 139,709,471 probably benign Het
Myh9 T C 15: 77,769,964 T1214A probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Neurl4 A C 11: 69,909,061 D1055A probably damaging Het
Nrbp1 T C 5: 31,250,599 probably null Het
Olfr1052 A T 2: 86,298,241 I142F possibly damaging Het
Olfr27 T C 9: 39,144,999 S300P probably benign Het
Olfr380 A T 11: 73,454,001 D70E probably damaging Het
Olfr421-ps1 T A 1: 174,152,312 Y265* probably null Het
Olfr53 T C 7: 140,652,243 V88A probably benign Het
Olfr67 T A 7: 103,787,995 H94L probably benign Het
Olfr901 T G 9: 38,430,812 Y177D probably damaging Het
Olfr933 T A 9: 38,975,759 F28I probably damaging Het
Patj C A 4: 98,677,321 N1090K possibly damaging Het
Pde8a A G 7: 81,328,035 D692G probably benign Het
Ppa2 G T 3: 133,367,842 K220N probably damaging Het
Rad54b A G 4: 11,597,865 H250R probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rgs14 A G 13: 55,383,753 T497A probably damaging Het
Rpl13-ps3 T A 14: 58,893,523 noncoding transcript Het
Sco1 A T 11: 67,055,800 H133L possibly damaging Het
Slc4a8 T C 15: 100,796,640 probably null Het
Smc2 C T 4: 52,440,238 probably benign Het
Spata18 T C 5: 73,666,902 I156T probably benign Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stt3a A G 9: 36,763,344 F48L probably damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Telo2 A T 17: 25,115,256 S6T possibly damaging Het
Tnfrsf11b T C 15: 54,252,095 M369V probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Vmn1r234 A T 17: 21,229,021 M66L probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Wdfy2 T A 14: 62,925,140 L97* probably null Het
Wdr63 C T 3: 146,068,806 D429N probably damaging Het
Xrcc5 T C 1: 72,394,720 *733Q probably null Het
Zadh2 A T 18: 84,094,501 I101F possibly damaging Het
Zfp516 G A 18: 82,987,497 G842D possibly damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7967:Scn11a UTSW 9 119804551 missense probably benign 0.01
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTATCTCTGAGACCAC -3'
(R):5'- ACTTGCTGGGGAAATCCAC -3'

Sequencing Primer
(F):5'- ATGGCTGCTGCTGTGAACAAC -3'
(R):5'- GGAAATCCACTCTGGTCTTCTGAATG -3'
Posted On2015-06-20