Incidental Mutation 'R4299:Scn11a'
ID 323500
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 041087-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R4299 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 119594572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1274 (I1274L)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: I1274L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I1274L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: I1274L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.3871 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 87,258,154 (GRCm39) probably null Het
Akna A T 4: 63,316,269 (GRCm39) D31E possibly damaging Het
Apbb2 A T 5: 66,470,721 (GRCm39) H528Q probably damaging Het
Atp6v1g3 C A 1: 138,211,462 (GRCm39) Y47* probably null Het
AW551984 T C 9: 39,504,275 (GRCm39) T564A probably benign Het
C4b T C 17: 34,950,118 (GRCm39) D1384G possibly damaging Het
Cbfa2t2 G A 2: 154,365,848 (GRCm39) V353I probably damaging Het
Ccdc121 A G 5: 31,644,870 (GRCm39) R208G possibly damaging Het
Cdh20 T C 1: 109,988,731 (GRCm39) I211T probably damaging Het
Cep170b T C 12: 112,705,739 (GRCm39) S1166P probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Crygs G A 16: 22,624,161 (GRCm39) Q149* probably null Het
Cyp2c70 T C 19: 40,172,372 (GRCm39) Q90R probably benign Het
Cyp3a41b T C 5: 145,510,487 (GRCm39) Y129C possibly damaging Het
Dnah10 A G 5: 124,896,989 (GRCm39) T3645A probably damaging Het
Dnai3 C T 3: 145,774,561 (GRCm39) D429N probably damaging Het
Dolk A T 2: 30,175,200 (GRCm39) W282R probably damaging Het
Dsg2 T A 18: 20,729,008 (GRCm39) probably null Het
Dysf A G 6: 84,045,059 (GRCm39) T297A possibly damaging Het
Flt1 G T 5: 147,620,717 (GRCm39) D142E probably benign Het
Frmd4a C A 2: 4,337,882 (GRCm39) N29K probably benign Het
Fxyd7 A T 7: 30,744,407 (GRCm39) M36K probably benign Het
Gabbr1 C T 17: 37,366,792 (GRCm39) R178* probably null Het
Gnal C G 18: 67,221,654 (GRCm39) P19R unknown Het
Gprc5b G A 7: 118,583,437 (GRCm39) A144V possibly damaging Het
Il1rapl1 A T X: 86,344,313 (GRCm39) I194N probably damaging Het
Kics2 C A 10: 121,581,351 (GRCm39) H117Q probably benign Het
Klhl24 T C 16: 19,925,754 (GRCm39) M94T probably damaging Het
Kmt2e T A 5: 23,669,912 (GRCm39) I133N probably damaging Het
Macf1 A G 4: 123,293,199 (GRCm39) I5381T probably damaging Het
Madd A G 2: 91,000,148 (GRCm39) L197P probably damaging Het
Mapkapk3 G A 9: 107,134,648 (GRCm39) T296M probably damaging Het
Micall2 T C 5: 139,695,226 (GRCm39) probably benign Het
Myh9 T C 15: 77,654,164 (GRCm39) T1214A probably benign Het
Ncapd3 A G 9: 26,963,623 (GRCm39) N492S probably benign Het
Neurl4 A C 11: 69,799,887 (GRCm39) D1055A probably damaging Het
Nrbp1 T C 5: 31,407,943 (GRCm39) probably null Het
Or13a20 T C 7: 140,232,156 (GRCm39) V88A probably benign Het
Or1e21 A T 11: 73,344,827 (GRCm39) D70E probably damaging Het
Or52z1 T A 7: 103,437,202 (GRCm39) H94L probably benign Het
Or5j3 A T 2: 86,128,585 (GRCm39) I142F possibly damaging Het
Or6k8-ps1 T A 1: 173,979,878 (GRCm39) Y265* probably null Het
Or8b42 T G 9: 38,342,108 (GRCm39) Y177D probably damaging Het
Or8d1b T A 9: 38,887,055 (GRCm39) F28I probably damaging Het
Or8g19 T C 9: 39,056,295 (GRCm39) S300P probably benign Het
Patj C A 4: 98,565,558 (GRCm39) N1090K possibly damaging Het
Pde8a A G 7: 80,977,783 (GRCm39) D692G probably benign Het
Ppa2 G T 3: 133,073,603 (GRCm39) K220N probably damaging Het
Pramel32 T C 4: 88,546,419 (GRCm39) K137E probably damaging Het
Ptgr3 A T 18: 84,112,626 (GRCm39) I101F possibly damaging Het
Rad54b A G 4: 11,597,865 (GRCm39) H250R probably damaging Het
Reln A C 5: 22,125,485 (GRCm39) C2733G probably damaging Het
Rgs14 A G 13: 55,531,566 (GRCm39) T497A probably damaging Het
Rpl13-ps3 T A 14: 59,130,972 (GRCm39) noncoding transcript Het
Sco1 A T 11: 66,946,626 (GRCm39) H133L possibly damaging Het
Slc4a8 T C 15: 100,694,521 (GRCm39) probably null Het
Smc2 C T 4: 52,440,238 (GRCm39) probably benign Het
Spata18 T C 5: 73,824,245 (GRCm39) I156T probably benign Het
St3gal2 T C 8: 111,688,991 (GRCm39) M177T probably benign Het
Stt3a A G 9: 36,674,640 (GRCm39) F48L probably damaging Het
Syvn1 C T 19: 6,099,951 (GRCm39) probably benign Het
Szt2 A G 4: 118,222,603 (GRCm39) probably benign Het
Telo2 A T 17: 25,334,230 (GRCm39) S6T possibly damaging Het
Tnfrsf11b T C 15: 54,115,491 (GRCm39) M369V probably benign Het
Tnfrsf13b C G 11: 61,031,643 (GRCm39) probably null Het
Vmn1r234 A T 17: 21,449,283 (GRCm39) M66L probably benign Het
Vmn2r12 C A 5: 109,239,830 (GRCm39) M244I probably benign Het
Wdfy2 T A 14: 63,162,589 (GRCm39) L97* probably null Het
Xrcc5 T C 1: 72,433,879 (GRCm39) *733Q probably null Het
Zfp1004 G A 2: 150,032,653 (GRCm39) D17N probably damaging Het
Zfp516 G A 18: 83,005,622 (GRCm39) G842D possibly damaging Het
Zwilch A G 9: 64,062,444 (GRCm39) probably null Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCCTTATCTCTGAGACCAC -3'
(R):5'- ACTTGCTGGGGAAATCCAC -3'

Sequencing Primer
(F):5'- ATGGCTGCTGCTGTGAACAAC -3'
(R):5'- GGAAATCCACTCTGGTCTTCTGAATG -3'
Posted On 2015-06-20