Incidental Mutation 'R4299:Olfr380'
ID323505
Institutional Source Beutler Lab
Gene Symbol Olfr380
Ensembl Gene ENSMUSG00000072709
Gene Nameolfactory receptor 380
SynonymsMOR135-1, GA_x6K02T2P1NL-3613021-3612086
MMRRC Submission 041087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4299 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73452886-73457508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73454001 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000116228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075532] [ENSMUST00000121209] [ENSMUST00000127789]
Predicted Effect probably damaging
Transcript: ENSMUST00000075532
AA Change: D70E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074971
Gene: ENSMUSG00000072709
AA Change: D70E

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:7tm_1 41 290 2e-35 PFAM
Pfam:7tm_4 139 283 7.9e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121209
AA Change: D70E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112462
Gene: ENSMUSG00000072709
AA Change: D70E

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:7tm_4 31 308 6.7e-56 PFAM
Pfam:7tm_1 41 290 6.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127789
AA Change: D70E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116228
Gene: ENSMUSG00000072709
AA Change: D70E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 231 7.3e-8 PFAM
Pfam:7tm_1 44 240 2.5e-33 PFAM
Pfam:7tm_4 142 249 4.5e-35 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,487,526 R208G possibly damaging Het
Abcc12 T C 8: 86,531,525 probably null Het
Akna A T 4: 63,398,032 D31E possibly damaging Het
Apbb2 A T 5: 66,313,378 H528Q probably damaging Het
Atp6v1g3 C A 1: 138,283,724 Y47* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
BC048403 C A 10: 121,745,446 H117Q probably benign Het
C4b T C 17: 34,731,144 D1384G possibly damaging Het
C87499 T C 4: 88,628,182 K137E probably damaging Het
Cbfa2t2 G A 2: 154,523,928 V353I probably damaging Het
Cdh7 T C 1: 110,061,001 I211T probably damaging Het
Cep170b T C 12: 112,739,305 S1166P probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs G A 16: 22,805,411 Q149* probably null Het
Cyp2c70 T C 19: 40,183,928 Q90R probably benign Het
Cyp3a41b T C 5: 145,573,677 Y129C possibly damaging Het
Dnah10 A G 5: 124,819,925 T3645A probably damaging Het
Dolk A T 2: 30,285,188 W282R probably damaging Het
Dsg2 T A 18: 20,595,951 probably null Het
Dysf A G 6: 84,068,077 T297A possibly damaging Het
Flt1 G T 5: 147,683,907 D142E probably benign Het
Frmd4a C A 2: 4,333,071 N29K probably benign Het
Fxyd7 A T 7: 31,044,982 M36K probably benign Het
Gabbr1 C T 17: 37,055,900 R178* probably null Het
Gm14139 G A 2: 150,190,733 D17N probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Il1rapl1 A T X: 87,300,707 I194N probably damaging Het
Klhl24 T C 16: 20,107,004 M94T probably damaging Het
Kmt2e T A 5: 23,464,914 I133N probably damaging Het
Macf1 A G 4: 123,399,406 I5381T probably damaging Het
Madd A G 2: 91,169,803 L197P probably damaging Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Micall2 T C 5: 139,709,471 probably benign Het
Myh9 T C 15: 77,769,964 T1214A probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Neurl4 A C 11: 69,909,061 D1055A probably damaging Het
Nrbp1 T C 5: 31,250,599 probably null Het
Olfr1052 A T 2: 86,298,241 I142F possibly damaging Het
Olfr27 T C 9: 39,144,999 S300P probably benign Het
Olfr421-ps1 T A 1: 174,152,312 Y265* probably null Het
Olfr53 T C 7: 140,652,243 V88A probably benign Het
Olfr67 T A 7: 103,787,995 H94L probably benign Het
Olfr901 T G 9: 38,430,812 Y177D probably damaging Het
Olfr933 T A 9: 38,975,759 F28I probably damaging Het
Patj C A 4: 98,677,321 N1090K possibly damaging Het
Pde8a A G 7: 81,328,035 D692G probably benign Het
Ppa2 G T 3: 133,367,842 K220N probably damaging Het
Rad54b A G 4: 11,597,865 H250R probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rgs14 A G 13: 55,383,753 T497A probably damaging Het
Rpl13-ps3 T A 14: 58,893,523 noncoding transcript Het
Scn11a T G 9: 119,765,506 I1274L probably damaging Het
Sco1 A T 11: 67,055,800 H133L possibly damaging Het
Slc4a8 T C 15: 100,796,640 probably null Het
Smc2 C T 4: 52,440,238 probably benign Het
Spata18 T C 5: 73,666,902 I156T probably benign Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stt3a A G 9: 36,763,344 F48L probably damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Telo2 A T 17: 25,115,256 S6T possibly damaging Het
Tnfrsf11b T C 15: 54,252,095 M369V probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Vmn1r234 A T 17: 21,229,021 M66L probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Wdfy2 T A 14: 62,925,140 L97* probably null Het
Wdr63 C T 3: 146,068,806 D429N probably damaging Het
Xrcc5 T C 1: 72,394,720 *733Q probably null Het
Zadh2 A T 18: 84,094,501 I101F possibly damaging Het
Zfp516 G A 18: 82,987,497 G842D possibly damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Olfr380
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr380 APN 11 73453477 missense probably damaging 1.00
IGL02388:Olfr380 APN 11 73453280 missense probably benign 0.19
IGL02898:Olfr380 APN 11 73453735 missense probably damaging 1.00
R0356:Olfr380 UTSW 11 73454080 missense possibly damaging 0.93
R1447:Olfr380 UTSW 11 73453874 missense probably benign 0.39
R1912:Olfr380 UTSW 11 73453994 missense probably damaging 0.98
R4362:Olfr380 UTSW 11 73453565 missense probably benign
R5686:Olfr380 UTSW 11 73453851 nonsense probably null
R7049:Olfr380 UTSW 11 73453604 missense probably damaging 1.00
R7751:Olfr380 UTSW 11 73453546 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGAGACTCATGATGCTGGTGT -3'
(R):5'- ACCAAACTCTCTTCAACCAGTTC -3'

Sequencing Primer
(F):5'- AGACTCATGATGCTGGTGTAGTGAAG -3'
(R):5'- AGTTCCTCCTCCTGGGC -3'
Posted On2015-06-20