Mutagenetix > Incidental Mutation

Incidental Mutation 'R4299:Tnfrsf11b'

323510

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf11b

Ensembl Gene

ENSMUSG00000063727

Gene Name

tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)

Synonyms

Opg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor

MMRRC Submission

041087-MU

Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587

Essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R4299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54250619-54278484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54252095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 369 (M369V)

Ref Sequence

ENSEMBL: ENSMUSP00000078705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079772]

AlphaFold

O08712

PDB Structure

Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000079772
AA Change: M369V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: M369V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	24	62	1.04e-2	SMART
TNFR	65	105	1.5e-8	SMART
TNFR	107	142	2.19e-10	SMART
TNFR	145	185	7.63e-1	SMART
DEATH	270	365	1.01e-9	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,526	R208G	possibly damaging	Het
Abcc12	T	C	8: 86,531,525		probably null	Het
Akna	A	T	4: 63,398,032	D31E	possibly damaging	Het
Apbb2	A	T	5: 66,313,378	H528Q	probably damaging	Het
Atp6v1g3	C	A	1: 138,283,724	Y47*	probably null	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
BC048403	C	A	10: 121,745,446	H117Q	probably benign	Het
C4b	T	C	17: 34,731,144	D1384G	possibly damaging	Het
C87499	T	C	4: 88,628,182	K137E	probably damaging	Het
Cbfa2t2	G	A	2: 154,523,928	V353I	probably damaging	Het
Cdh7	T	C	1: 110,061,001	I211T	probably damaging	Het
Cep170b	T	C	12: 112,739,305	S1166P	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	G	A	16: 22,805,411	Q149*	probably null	Het
Cyp2c70	T	C	19: 40,183,928	Q90R	probably benign	Het
Cyp3a41b	T	C	5: 145,573,677	Y129C	possibly damaging	Het
Dnah10	A	G	5: 124,819,925	T3645A	probably damaging	Het
Dolk	A	T	2: 30,285,188	W282R	probably damaging	Het
Dsg2	T	A	18: 20,595,951		probably null	Het
Dysf	A	G	6: 84,068,077	T297A	possibly damaging	Het
Flt1	G	T	5: 147,683,907	D142E	probably benign	Het
Frmd4a	C	A	2: 4,333,071	N29K	probably benign	Het
Fxyd7	A	T	7: 31,044,982	M36K	probably benign	Het
Gabbr1	C	T	17: 37,055,900	R178*	probably null	Het
Gm14139	G	A	2: 150,190,733	D17N	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Il1rapl1	A	T	X: 87,300,707	I194N	probably damaging	Het
Klhl24	T	C	16: 20,107,004	M94T	probably damaging	Het
Kmt2e	T	A	5: 23,464,914	I133N	probably damaging	Het
Macf1	A	G	4: 123,399,406	I5381T	probably damaging	Het
Madd	A	G	2: 91,169,803	L197P	probably damaging	Het
Mapkapk3	G	A	9: 107,257,449	T296M	probably damaging	Het
Micall2	T	C	5: 139,709,471		probably benign	Het
Myh9	T	C	15: 77,769,964	T1214A	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Neurl4	A	C	11: 69,909,061	D1055A	probably damaging	Het
Nrbp1	T	C	5: 31,250,599		probably null	Het
Olfr1052	A	T	2: 86,298,241	I142F	possibly damaging	Het
Olfr27	T	C	9: 39,144,999	S300P	probably benign	Het
Olfr380	A	T	11: 73,454,001	D70E	probably damaging	Het
Olfr421-ps1	T	A	1: 174,152,312	Y265*	probably null	Het
Olfr53	T	C	7: 140,652,243	V88A	probably benign	Het
Olfr67	T	A	7: 103,787,995	H94L	probably benign	Het
Olfr901	T	G	9: 38,430,812	Y177D	probably damaging	Het
Olfr933	T	A	9: 38,975,759	F28I	probably damaging	Het
Patj	C	A	4: 98,677,321	N1090K	possibly damaging	Het
Pde8a	A	G	7: 81,328,035	D692G	probably benign	Het
Ppa2	G	T	3: 133,367,842	K220N	probably damaging	Het
Rad54b	A	G	4: 11,597,865	H250R	probably damaging	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rgs14	A	G	13: 55,383,753	T497A	probably damaging	Het
Rpl13-ps3	T	A	14: 58,893,523		noncoding transcript	Het
Scn11a	T	G	9: 119,765,506	I1274L	probably damaging	Het
Sco1	A	T	11: 67,055,800	H133L	possibly damaging	Het
Slc4a8	T	C	15: 100,796,640		probably null	Het
Smc2	C	T	4: 52,440,238		probably benign	Het
Spata18	T	C	5: 73,666,902	I156T	probably benign	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stt3a	A	G	9: 36,763,344	F48L	probably damaging	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Telo2	A	T	17: 25,115,256	S6T	possibly damaging	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Vmn1r234	A	T	17: 21,229,021	M66L	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Wdfy2	T	A	14: 62,925,140	L97*	probably null	Het
Wdr63	C	T	3: 146,068,806	D429N	probably damaging	Het
Xrcc5	T	C	1: 72,394,720	*733Q	probably null	Het
Zadh2	A	T	18: 84,094,501	I101F	possibly damaging	Het
Zfp516	G	A	18: 82,987,497	G842D	possibly damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Tnfrsf11b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Tnfrsf11b	APN	15	54259842	missense	probably damaging	1.00
IGL00770:Tnfrsf11b	APN	15	54254072	missense	probably benign	0.16
IGL00774:Tnfrsf11b	APN	15	54254072	missense	probably benign	0.16
IGL02355:Tnfrsf11b	APN	15	54252382	missense	probably damaging	0.96
IGL02362:Tnfrsf11b	APN	15	54252382	missense	probably damaging	0.96
IGL02711:Tnfrsf11b	APN	15	54256136	missense	probably benign	0.01
IGL02870:Tnfrsf11b	APN	15	54256027	missense	probably benign	0.05
IGL03219:Tnfrsf11b	APN	15	54254178	nonsense	probably null
P0012:Tnfrsf11b	UTSW	15	54259798	splice site	probably benign
R1550:Tnfrsf11b	UTSW	15	54254058	missense	possibly damaging	0.94
R1813:Tnfrsf11b	UTSW	15	54256097	nonsense	probably null
R3840:Tnfrsf11b	UTSW	15	54252082	missense	probably damaging	0.99
R3910:Tnfrsf11b	UTSW	15	54256182	splice site	probably benign
R3911:Tnfrsf11b	UTSW	15	54256182	splice site	probably benign
R3912:Tnfrsf11b	UTSW	15	54256182	splice site	probably benign
R4362:Tnfrsf11b	UTSW	15	54256159	missense	possibly damaging	0.94
R4363:Tnfrsf11b	UTSW	15	54256159	missense	possibly damaging	0.94
R5288:Tnfrsf11b	UTSW	15	54278226	missense	probably benign	0.00
R5653:Tnfrsf11b	UTSW	15	54259866	missense	probably damaging	1.00
R5753:Tnfrsf11b	UTSW	15	54254059	missense	possibly damaging	0.90
R6881:Tnfrsf11b	UTSW	15	54254143	missense	probably benign	0.00
R6997:Tnfrsf11b	UTSW	15	54252374	missense	probably damaging	0.99
R7704:Tnfrsf11b	UTSW	15	54260101	missense	probably benign	0.30
R7730:Tnfrsf11b	UTSW	15	54254074	nonsense	probably null
R8017:Tnfrsf11b	UTSW	15	54254202	nonsense	probably null
R8052:Tnfrsf11b	UTSW	15	54252106	missense	probably damaging	1.00
R8060:Tnfrsf11b	UTSW	15	54254109	missense	probably benign	0.38
R8711:Tnfrsf11b	UTSW	15	54260112	missense	possibly damaging	0.81
R9224:Tnfrsf11b	UTSW	15	54252160	missense	possibly damaging	0.67
X0025:Tnfrsf11b	UTSW	15	54278235	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AGAAACAGTCTTCTTCTCCTCAG -3'
(R):5'- CAGAGCAGCTTCTTGCCTTG -3'

Sequencing Primer
(F):5'- CAGTCAGTTTTGGCCCATCTTGAAG -3'
(R):5'- CTTGCCTTGATGGAGAGCC -3'

Posted On

2015-06-20