Incidental Mutation 'R4299:Gabbr1'
ID323518
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 041087-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R4299 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 37055900 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 178 (R178*)
Ref Sequence ENSEMBL: ENSMUSP00000134346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823] [ENSMUST00000174347]
Predicted Effect probably null
Transcript: ENSMUST00000025338
AA Change: R339*
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: R339*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172792
AA Change: R223*
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: R223*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173564
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174347
AA Change: R178*
SMART Domains Protein: ENSMUSP00000134346
Gene: ENSMUSG00000024462
AA Change: R178*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:ANF_receptor 102 213 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174866
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,487,526 R208G possibly damaging Het
Abcc12 T C 8: 86,531,525 probably null Het
Akna A T 4: 63,398,032 D31E possibly damaging Het
Apbb2 A T 5: 66,313,378 H528Q probably damaging Het
Atp6v1g3 C A 1: 138,283,724 Y47* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
BC048403 C A 10: 121,745,446 H117Q probably benign Het
C4b T C 17: 34,731,144 D1384G possibly damaging Het
C87499 T C 4: 88,628,182 K137E probably damaging Het
Cbfa2t2 G A 2: 154,523,928 V353I probably damaging Het
Cdh7 T C 1: 110,061,001 I211T probably damaging Het
Cep170b T C 12: 112,739,305 S1166P probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs G A 16: 22,805,411 Q149* probably null Het
Cyp2c70 T C 19: 40,183,928 Q90R probably benign Het
Cyp3a41b T C 5: 145,573,677 Y129C possibly damaging Het
Dnah10 A G 5: 124,819,925 T3645A probably damaging Het
Dolk A T 2: 30,285,188 W282R probably damaging Het
Dsg2 T A 18: 20,595,951 probably null Het
Dysf A G 6: 84,068,077 T297A possibly damaging Het
Flt1 G T 5: 147,683,907 D142E probably benign Het
Frmd4a C A 2: 4,333,071 N29K probably benign Het
Fxyd7 A T 7: 31,044,982 M36K probably benign Het
Gm14139 G A 2: 150,190,733 D17N probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Il1rapl1 A T X: 87,300,707 I194N probably damaging Het
Klhl24 T C 16: 20,107,004 M94T probably damaging Het
Kmt2e T A 5: 23,464,914 I133N probably damaging Het
Macf1 A G 4: 123,399,406 I5381T probably damaging Het
Madd A G 2: 91,169,803 L197P probably damaging Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Micall2 T C 5: 139,709,471 probably benign Het
Myh9 T C 15: 77,769,964 T1214A probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Neurl4 A C 11: 69,909,061 D1055A probably damaging Het
Nrbp1 T C 5: 31,250,599 probably null Het
Olfr1052 A T 2: 86,298,241 I142F possibly damaging Het
Olfr27 T C 9: 39,144,999 S300P probably benign Het
Olfr380 A T 11: 73,454,001 D70E probably damaging Het
Olfr421-ps1 T A 1: 174,152,312 Y265* probably null Het
Olfr53 T C 7: 140,652,243 V88A probably benign Het
Olfr67 T A 7: 103,787,995 H94L probably benign Het
Olfr901 T G 9: 38,430,812 Y177D probably damaging Het
Olfr933 T A 9: 38,975,759 F28I probably damaging Het
Patj C A 4: 98,677,321 N1090K possibly damaging Het
Pde8a A G 7: 81,328,035 D692G probably benign Het
Ppa2 G T 3: 133,367,842 K220N probably damaging Het
Rad54b A G 4: 11,597,865 H250R probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rgs14 A G 13: 55,383,753 T497A probably damaging Het
Rpl13-ps3 T A 14: 58,893,523 noncoding transcript Het
Scn11a T G 9: 119,765,506 I1274L probably damaging Het
Sco1 A T 11: 67,055,800 H133L possibly damaging Het
Slc4a8 T C 15: 100,796,640 probably null Het
Smc2 C T 4: 52,440,238 probably benign Het
Spata18 T C 5: 73,666,902 I156T probably benign Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stt3a A G 9: 36,763,344 F48L probably damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Telo2 A T 17: 25,115,256 S6T possibly damaging Het
Tnfrsf11b T C 15: 54,252,095 M369V probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Vmn1r234 A T 17: 21,229,021 M66L probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Wdfy2 T A 14: 62,925,140 L97* probably null Het
Wdr63 C T 3: 146,068,806 D429N probably damaging Het
Xrcc5 T C 1: 72,394,720 *733Q probably null Het
Zadh2 A T 18: 84,094,501 I101F possibly damaging Het
Zfp516 G A 18: 82,987,497 G842D possibly damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 splice site probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
R7786:Gabbr1 UTSW 17 37070063 missense probably damaging 0.98
R7793:Gabbr1 UTSW 17 37047501 missense probably benign 0.13
R7833:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
R8110:Gabbr1 UTSW 17 37048583 missense probably benign 0.10
R8318:Gabbr1 UTSW 17 37062543 missense probably benign 0.23
R8774:Gabbr1 UTSW 17 37071857 missense probably damaging 1.00
R8774-TAIL:Gabbr1 UTSW 17 37071857 missense probably damaging 1.00
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Z1177:Gabbr1 UTSW 17 37048424 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- ATCCTCTCCTCATGGGGTTTAG -3'
(R):5'- GAGCCGTCTCACAGAATGAAC -3'

Sequencing Primer
(F):5'- AGGGGCTCTTGGAATAAGGTTCAG -3'
(R):5'- TGAACAACTGCCTCTTCCAGG -3'
Posted On2015-06-20