Mutagenetix > Incidental Mutations

Incidental Mutation 'R4299:Gabbr1'

323518

Institutional Source

Beutler Lab

Gene Symbol

Gabbr1

Ensembl Gene

ENSMUSG00000024462

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 1

Synonyms

GABAB1, GABAbR1

MMRRC Submission

041087-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.596) question?

Stock #

R4299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37045966-37075067 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 37055900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 178 (R178*)

Ref Sequence

ENSEMBL: ENSMUSP00000134346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823] [ENSMUST00000174347]

AlphaFold

Q9WV18

Predicted Effect

probably null
Transcript: ENSMUST00000025338
AA Change: R339*

SMART Domains

Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: R339*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CCP	29	95	8.72e0	SMART
CCP	99	156	3.03e-10	SMART
Pfam:Peripla_BP_6	168	538	1.6e-23	PFAM
Pfam:ANF_receptor	186	542	4.3e-73	PFAM
Pfam:7tm_3	602	858	9.8e-49	PFAM
coiled coil region	877	922	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172792
AA Change: R223*

SMART Domains

Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: R223*

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:Peripla_BP_6	52	428	7.8e-24	PFAM
Pfam:ANF_receptor	70	426	5.7e-68	PFAM
Pfam:7tm_3	484	743	1.1e-50	PFAM
coiled coil region	761	806	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173564

Predicted Effect

probably benign
Transcript: ENSMUST00000173823

SMART Domains

Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sushi	29	95	1.6e-6	PFAM
low complexity region	159	176	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000174347
AA Change: R178*

SMART Domains

Protein: ENSMUSP00000134346
Gene: ENSMUSG00000024462
AA Change: R178*

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:ANF_receptor	102	213	1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174866

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,526	R208G	possibly damaging	Het
Abcc12	T	C	8: 86,531,525		probably null	Het
Akna	A	T	4: 63,398,032	D31E	possibly damaging	Het
Apbb2	A	T	5: 66,313,378	H528Q	probably damaging	Het
Atp6v1g3	C	A	1: 138,283,724	Y47*	probably null	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
BC048403	C	A	10: 121,745,446	H117Q	probably benign	Het
C4b	T	C	17: 34,731,144	D1384G	possibly damaging	Het
C87499	T	C	4: 88,628,182	K137E	probably damaging	Het
Cbfa2t2	G	A	2: 154,523,928	V353I	probably damaging	Het
Cdh7	T	C	1: 110,061,001	I211T	probably damaging	Het
Cep170b	T	C	12: 112,739,305	S1166P	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	G	A	16: 22,805,411	Q149*	probably null	Het
Cyp2c70	T	C	19: 40,183,928	Q90R	probably benign	Het
Cyp3a41b	T	C	5: 145,573,677	Y129C	possibly damaging	Het
Dnah10	A	G	5: 124,819,925	T3645A	probably damaging	Het
Dolk	A	T	2: 30,285,188	W282R	probably damaging	Het
Dsg2	T	A	18: 20,595,951		probably null	Het
Dysf	A	G	6: 84,068,077	T297A	possibly damaging	Het
Flt1	G	T	5: 147,683,907	D142E	probably benign	Het
Frmd4a	C	A	2: 4,333,071	N29K	probably benign	Het
Fxyd7	A	T	7: 31,044,982	M36K	probably benign	Het
Gm14139	G	A	2: 150,190,733	D17N	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Il1rapl1	A	T	X: 87,300,707	I194N	probably damaging	Het
Klhl24	T	C	16: 20,107,004	M94T	probably damaging	Het
Kmt2e	T	A	5: 23,464,914	I133N	probably damaging	Het
Macf1	A	G	4: 123,399,406	I5381T	probably damaging	Het
Madd	A	G	2: 91,169,803	L197P	probably damaging	Het
Mapkapk3	G	A	9: 107,257,449	T296M	probably damaging	Het
Micall2	T	C	5: 139,709,471		probably benign	Het
Myh9	T	C	15: 77,769,964	T1214A	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Neurl4	A	C	11: 69,909,061	D1055A	probably damaging	Het
Nrbp1	T	C	5: 31,250,599		probably null	Het
Olfr1052	A	T	2: 86,298,241	I142F	possibly damaging	Het
Olfr27	T	C	9: 39,144,999	S300P	probably benign	Het
Olfr380	A	T	11: 73,454,001	D70E	probably damaging	Het
Olfr421-ps1	T	A	1: 174,152,312	Y265*	probably null	Het
Olfr53	T	C	7: 140,652,243	V88A	probably benign	Het
Olfr67	T	A	7: 103,787,995	H94L	probably benign	Het
Olfr901	T	G	9: 38,430,812	Y177D	probably damaging	Het
Olfr933	T	A	9: 38,975,759	F28I	probably damaging	Het
Patj	C	A	4: 98,677,321	N1090K	possibly damaging	Het
Pde8a	A	G	7: 81,328,035	D692G	probably benign	Het
Ppa2	G	T	3: 133,367,842	K220N	probably damaging	Het
Rad54b	A	G	4: 11,597,865	H250R	probably damaging	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rgs14	A	G	13: 55,383,753	T497A	probably damaging	Het
Rpl13-ps3	T	A	14: 58,893,523		noncoding transcript	Het
Scn11a	T	G	9: 119,765,506	I1274L	probably damaging	Het
Sco1	A	T	11: 67,055,800	H133L	possibly damaging	Het
Slc4a8	T	C	15: 100,796,640		probably null	Het
Smc2	C	T	4: 52,440,238		probably benign	Het
Spata18	T	C	5: 73,666,902	I156T	probably benign	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stt3a	A	G	9: 36,763,344	F48L	probably damaging	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Telo2	A	T	17: 25,115,256	S6T	possibly damaging	Het
Tnfrsf11b	T	C	15: 54,252,095	M369V	probably benign	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Vmn1r234	A	T	17: 21,229,021	M66L	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Wdfy2	T	A	14: 62,925,140	L97*	probably null	Het
Wdr63	C	T	3: 146,068,806	D429N	probably damaging	Het
Xrcc5	T	C	1: 72,394,720	*733Q	probably null	Het
Zadh2	A	T	18: 84,094,501	I101F	possibly damaging	Het
Zfp516	G	A	18: 82,987,497	G842D	possibly damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in Gabbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Gabbr1	APN	17	37048443	nonsense	probably null
IGL01309:Gabbr1	APN	17	37048607	critical splice donor site	probably null
IGL01413:Gabbr1	APN	17	37062706	missense	possibly damaging	0.93
IGL01568:Gabbr1	APN	17	37070669	missense	probably damaging	1.00
IGL01845:Gabbr1	APN	17	37048414	splice site	probably benign
IGL02083:Gabbr1	APN	17	37070065	missense	possibly damaging	0.84
IGL02302:Gabbr1	APN	17	37054797	missense	probably damaging	1.00
IGL02430:Gabbr1	APN	17	37056308	nonsense	probably null
IGL02533:Gabbr1	APN	17	37072147	missense	probably damaging	1.00
IGL02810:Gabbr1	APN	17	37062762	missense	probably damaging	1.00
H8562:Gabbr1	UTSW	17	37071949	missense	probably damaging	1.00
PIT4449001:Gabbr1	UTSW	17	37056350	missense	probably damaging	1.00
R0025:Gabbr1	UTSW	17	37067210	intron	probably benign
R0420:Gabbr1	UTSW	17	37046762	missense	possibly damaging	0.68
R0464:Gabbr1	UTSW	17	37050834	unclassified	probably benign
R1306:Gabbr1	UTSW	17	37055990	splice site	probably null
R1412:Gabbr1	UTSW	17	37054913	splice site	probably null
R1495:Gabbr1	UTSW	17	37055940	missense	possibly damaging	0.68
R1612:Gabbr1	UTSW	17	37070669	missense	probably damaging	1.00
R1658:Gabbr1	UTSW	17	37047507	missense	probably damaging	0.96
R1763:Gabbr1	UTSW	17	37054767	missense	probably damaging	1.00
R1779:Gabbr1	UTSW	17	37054879	missense	probably damaging	1.00
R1964:Gabbr1	UTSW	17	37048459	missense	probably damaging	1.00
R1996:Gabbr1	UTSW	17	37069220	missense	probably damaging	1.00
R2014:Gabbr1	UTSW	17	37056782	splice site	probably null
R2255:Gabbr1	UTSW	17	37071866	missense	probably damaging	1.00
R4458:Gabbr1	UTSW	17	37067775	critical splice acceptor site	probably null
R4510:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4511:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4571:Gabbr1	UTSW	17	37054236	nonsense	probably null
R4597:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.74
R5109:Gabbr1	UTSW	17	37072028	intron	probably benign
R5119:Gabbr1	UTSW	17	37048438	missense	probably damaging	0.99
R5227:Gabbr1	UTSW	17	37070066	missense	possibly damaging	0.93
R5253:Gabbr1	UTSW	17	37055913	missense	possibly damaging	0.87
R5443:Gabbr1	UTSW	17	37070756	missense	probably damaging	1.00
R5485:Gabbr1	UTSW	17	37056875	missense	possibly damaging	0.83
R5839:Gabbr1	UTSW	17	37067868	missense	probably damaging	1.00
R5976:Gabbr1	UTSW	17	37067862	missense	probably damaging	1.00
R6156:Gabbr1	UTSW	17	37048427	missense	probably benign	0.01
R6167:Gabbr1	UTSW	17	37063379	missense	probably damaging	1.00
R6214:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6215:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6348:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.94
R6721:Gabbr1	UTSW	17	37054192	missense	probably damaging	0.98
R7028:Gabbr1	UTSW	17	37064737	nonsense	probably null
R7317:Gabbr1	UTSW	17	37069413	missense	probably damaging	1.00
R7786:Gabbr1	UTSW	17	37070063	missense	probably damaging	0.98
R7793:Gabbr1	UTSW	17	37047501	missense	probably benign	0.13
R7833:Gabbr1	UTSW	17	37056969	missense	possibly damaging	0.88
R8110:Gabbr1	UTSW	17	37048583	missense	probably benign	0.10
R8318:Gabbr1	UTSW	17	37062543	missense	probably benign	0.23
R8774:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8774-TAIL:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8890:Gabbr1	UTSW	17	37047544	missense	probably benign	0.02
R9144:Gabbr1	UTSW	17	37051157	missense	probably benign
R9292:Gabbr1	UTSW	17	37055892	missense	possibly damaging	0.94
R9359:Gabbr1	UTSW	17	37070713	missense	probably damaging	1.00
X0010:Gabbr1	UTSW	17	37070780	missense	probably damaging	0.99
Z1177:Gabbr1	UTSW	17	37048424	missense	possibly damaging	0.57

Predicted Primers

PCR Primer
(F):5'- ATCCTCTCCTCATGGGGTTTAG -3'
(R):5'- GAGCCGTCTCACAGAATGAAC -3'

Sequencing Primer
(F):5'- AGGGGCTCTTGGAATAAGGTTCAG -3'
(R):5'- TGAACAACTGCCTCTTCCAGG -3'

Posted On

2015-06-20