Incidental Mutation 'R2326:Prph'
ID323526
Institutional Source Beutler Lab
Gene Symbol Prph
Ensembl Gene ENSMUSG00000023484
Gene Nameperipherin
SynonymsPrph1
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R2326 (G1)
Quality Score55
Status Validated
Chromosome15
Chromosomal Location99055174-99058978 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 99055282 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024249] [ENSMUST00000047104] [ENSMUST00000229268] [ENSMUST00000230021]
Predicted Effect unknown
Transcript: ENSMUST00000024249
AA Change: R26G
SMART Domains Protein: ENSMUSP00000024249
Gene: ENSMUSG00000023484
AA Change: R26G

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 2.7e-18 PFAM
Pfam:Filament 100 410 4.5e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000047104
AA Change: R26G
SMART Domains Protein: ENSMUSP00000049303
Gene: ENSMUSG00000023484
AA Change: R26G

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 3.2e-18 PFAM
Filament 100 442 1.87e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229268
Predicted Effect unknown
Transcript: ENSMUST00000230021
AA Change: R26G
Meta Mutation Damage Score 0.4348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice showed no overt phenotype up to 14 months of age. While overall structure, number, and caliber of large myelinated axons was normal, mice had reduced numbers of a small subset of unmelinated sensory axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Prph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Prph APN 15 99058636 missense possibly damaging 0.88
IGL01472:Prph APN 15 99058593 splice site probably benign
IGL01868:Prph APN 15 99056343 missense probably damaging 1.00
IGL02714:Prph APN 15 99056866 missense probably damaging 1.00
IGL02816:Prph APN 15 99057420 missense probably damaging 0.97
R0242:Prph UTSW 15 99055727 missense probably damaging 1.00
R0396:Prph UTSW 15 99056991 missense probably benign
R0441:Prph UTSW 15 99057438 missense probably damaging 1.00
R2065:Prph UTSW 15 99056133 missense probably damaging 1.00
R3115:Prph UTSW 15 99055456 missense probably damaging 1.00
R4441:Prph UTSW 15 99057124 missense probably damaging 1.00
R4794:Prph UTSW 15 99057427 missense probably damaging 1.00
R5058:Prph UTSW 15 99055232 unclassified probably benign
R5463:Prph UTSW 15 99055400 missense probably benign 0.43
R6199:Prph UTSW 15 99056832 missense probably benign 0.33
R6242:Prph UTSW 15 99057123 missense probably damaging 0.99
R6502:Prph UTSW 15 99056386 missense probably damaging 1.00
R7356:Prph UTSW 15 99056926 missense probably damaging 1.00
R7818:Prph UTSW 15 99057872 missense probably damaging 1.00
R8353:Prph UTSW 15 99056776 missense probably benign 0.02
Z1177:Prph UTSW 15 99056380 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATCTCAGCCAGCAACAAG -3'
(R):5'- TCGGCCATGGAGAAATCGAG -3'

Sequencing Primer
(F):5'- GCTGAAGTCAGGCCAGTG -3'
(R):5'- TGGAGAAATCGAGGCGCTCC -3'
Posted On2015-06-22