Mutagenetix > Incidental Mutations

Incidental Mutation 'R2091:Myo3a'

323535

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

040096-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22333677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 442 (H442L)

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044749
AA Change: H450L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: H450L

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000153002
AA Change: H442L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: H442L

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Meta Mutation Damage Score

0.5688

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	C	2: 19,517,546	N247K	probably damaging	Het
4930402F06Rik	T	C	2: 35,376,067	K197R	probably benign	Het
4932438A13Rik	C	T	3: 36,988,256	T2797I	probably damaging	Het
4932438A13Rik	T	C	3: 36,953,970	V1725A	probably damaging	Het
9130011E15Rik	A	T	19: 45,952,680	L300Q	probably damaging	Het
AA986860	T	C	1: 130,743,169	L376P	probably benign	Het
Adamts10	T	C	17: 33,551,192		probably null	Het
Adamts7	T	C	9: 90,188,440		probably null	Het
Adgrl1	T	C	8: 83,934,464	I862T	probably damaging	Het
Agbl1	G	A	7: 76,589,500	V583M	probably damaging	Het
Apba2	T	A	7: 64,695,593	V177D	probably benign	Het
Arfgap2	A	G	2: 91,270,241	K297R	probably benign	Het
Atg14	A	T	14: 47,542,895	I474N	probably damaging	Het
Atp2b4	C	A	1: 133,715,230	V1046F	probably benign	Het
Best1	A	G	19: 9,992,079	V205A	probably benign	Het
Bicdl1	A	G	5: 115,724,579	S206P	probably damaging	Het
Cacna1h	C	T	17: 25,432,876	C98Y	possibly damaging	Het
Calhm3	T	A	19: 47,151,991	D221V	probably damaging	Het
Ccdc93	T	A	1: 121,483,342		probably null	Het
Cd248	A	T	19: 5,070,046	I641F	possibly damaging	Het
Chrnb3	C	T	8: 27,394,234	T333M	probably damaging	Het
Cyb5rl	A	G	4: 107,071,006	H113R	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddx59	T	A	1: 136,416,709	D39E	probably benign	Het
Defa5	A	G	8: 21,297,497	D20G	probably damaging	Het
Dido1	A	T	2: 180,661,884	V1409E	probably benign	Het
Dlc1	A	T	8: 36,937,609	V342E	probably benign	Het
Dsc2	G	A	18: 20,033,294	T760I	possibly damaging	Het
Dync1h1	A	G	12: 110,649,588	I3057V	probably benign	Het
Etnk2	T	G	1: 133,377,053		probably null	Het
Fbp2	G	T	13: 62,858,207	L31I	probably damaging	Het
Gbp7	A	T	3: 142,534,622	I34F	probably damaging	Het
Gcfc2	A	G	6: 81,943,479	E415G	probably damaging	Het
Glp1r	T	C	17: 30,925,549	L232P	probably damaging	Het
Gm10822	A	G	2: 73,899,275		noncoding transcript	Het
Gm42669	G	A	5: 107,507,910	V1192M	probably benign	Het
Gpr37	A	G	6: 25,689,063	S12P	possibly damaging	Het
Gpt	A	G	15: 76,697,976	E211G	possibly damaging	Het
Grxcr1	T	C	5: 68,110,412	I168T	probably damaging	Het
Hat1	T	C	2: 71,434,034	V272A	probably benign	Het
Igkv8-30	A	C	6: 70,117,086	C114G	probably damaging	Het
Kcne4	T	C	1: 78,817,907	S91P	probably benign	Het
Kif5b	G	A	18: 6,213,248	Q715*	probably null	Het
Lamb1	T	A	12: 31,287,429	N386K	probably damaging	Het
Lcmt2	T	C	2: 121,138,616	N662S	probably damaging	Het
Lnx1	G	T	5: 74,620,066	H324N	probably benign	Het
Lrrc4	T	G	6: 28,830,587	D343A	probably benign	Het
Mars	A	G	10: 127,299,285	S646P	probably damaging	Het
Mboat7	T	C	7: 3,684,011		probably benign	Het
Mlip	C	T	9: 77,164,863	V341I	possibly damaging	Het
Mterf1b	A	T	5: 4,197,057	T233S	possibly damaging	Het
Myrf	A	T	19: 10,224,600	V171D	possibly damaging	Het
Nbas	G	A	12: 13,361,045	D897N	probably benign	Het
Nfx1	T	C	4: 40,977,004	V226A	probably benign	Het
Nlrp4a	T	C	7: 26,450,153	L395P	probably damaging	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Nsun6	A	G	2: 15,039,731		probably null	Het
Ntrk2	A	G	13: 58,859,301	H239R	possibly damaging	Het
Olfr1301	A	T	2: 111,754,386	M46L	probably benign	Het
Olfr259	T	C	2: 87,108,262	N42D	probably damaging	Het
Olfr495	A	G	7: 108,395,861	H247R	probably damaging	Het
Olfr979	T	C	9: 40,001,204	T8A	probably benign	Het
Pate4	C	A	9: 35,608,257	A46S	possibly damaging	Het
Pcdhb18	T	C	18: 37,490,600	S328P	probably damaging	Het
Pdk4	A	G	6: 5,494,857		probably benign	Het
Pigm	T	C	1: 172,377,533	Y279H	probably damaging	Het
Pla2g16	A	G	19: 7,579,109	I92V	probably damaging	Het
Plxdc2	A	G	2: 16,713,683	I379M	probably damaging	Het
Ppp1r35	A	G	5: 137,779,894	N217S	possibly damaging	Het
Prex1	G	A	2: 166,569,365	T1438I	possibly damaging	Het
Ptger4	T	A	15: 5,242,845	I98F	possibly damaging	Het
Rasl11a	T	A	5: 146,847,117	I124N	probably damaging	Het
Rest	A	G	5: 77,281,279	K515R	possibly damaging	Het
Ryr1	A	G	7: 29,086,049	L1746P	probably damaging	Het
Ryr2	G	T	13: 11,945,977	T25K	probably benign	Het
Sacs	A	T	14: 61,191,919	I476L	possibly damaging	Het
Serpina3g	A	T	12: 104,239,158	D52V	probably damaging	Het
Skint6	T	C	4: 112,846,684	N998S	probably benign	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc10a4	G	A	5: 73,017,139		probably benign	Het
Slc24a2	G	T	4: 87,011,646	P538T	probably damaging	Het
Sntg1	T	A	1: 8,595,539	T184S	probably benign	Het
Ssbp1	A	G	6: 40,476,499	Y73C	probably null	Het
St18	G	A	1: 6,827,971	V666M	probably benign	Het
Suclg1	A	G	6: 73,264,276	K193R	probably benign	Het
Tcp11l1	T	C	2: 104,684,139	I428V	possibly damaging	Het
Th	T	A	7: 142,895,543	D275V	probably damaging	Het
Tnrc18	A	C	5: 142,773,641	S813R	unknown	Het
Tnrc6a	T	C	7: 123,172,120		probably null	Het
Trap1	A	C	16: 4,046,039	Y472*	probably null	Het
Trdv1	C	A	14: 53,882,169	Q96K	probably benign	Het
Trpm8	T	C	1: 88,343,326	I446T	probably damaging	Het
Tti2	T	C	8: 31,154,266	L297P	probably damaging	Het
Ttn	C	T	2: 76,735,011	G26545R	probably damaging	Het
Ttn	T	C	2: 76,757,144	D13208G	probably damaging	Het
Tubb3	A	G	8: 123,421,678		probably null	Het
Umodl1	A	G	17: 30,971,919	M247V	probably benign	Het
Wrn	T	A	8: 33,267,825	H812L	probably benign	Het
Zfp174	A	G	16: 3,854,642	R352G	possibly damaging	Het
Zfp955a	T	A	17: 33,242,757	K134*	probably null	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GCAATGGCTGATTTGGGATAC -3'
(R):5'- ACCACTGAGATCATTCCCACTG -3'

Sequencing Primer
(F):5'- CCAGTCTATGGTCACATATAATGCAG -3'
(R):5'- GAGATCATTCCCACTGCTCTTTG -3'

Posted On

2015-06-24