Incidental Mutation 'R2091:Tubb3'
ID323562
Institutional Source Beutler Lab
Gene Symbol Tubb3
Ensembl Gene ENSMUSG00000062380
Gene Nametubulin, beta 3 class III
SynonymsbetaIII-tubulin, 3200002H15Rik
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123411424-123422015 bp(+) (GRCm38)
Type of Mutationunclassified (584 bp from exon)
DNA Base Change (assembly) A to G at 123421678 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000127664] [ENSMUST00000212743] [ENSMUST00000212883]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071134
AA Change: K450R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380
AA Change: K450R

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit neonatal lethality associated with respiratory distress, abnormal corpus callosum morphology, abnormal cranial nerves, and defective axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
4932438A13Rik T C 3: 36,953,970 V1725A probably damaging Het
9130011E15Rik A T 19: 45,952,680 L300Q probably damaging Het
AA986860 T C 1: 130,743,169 L376P probably benign Het
Adamts10 T C 17: 33,551,192 probably null Het
Adamts7 T C 9: 90,188,440 probably null Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Arfgap2 A G 2: 91,270,241 K297R probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Atp2b4 C A 1: 133,715,230 V1046F probably benign Het
Best1 A G 19: 9,992,079 V205A probably benign Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Cacna1h C T 17: 25,432,876 C98Y possibly damaging Het
Calhm3 T A 19: 47,151,991 D221V probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Cd248 A T 19: 5,070,046 I641F possibly damaging Het
Chrnb3 C T 8: 27,394,234 T333M probably damaging Het
Cyb5rl A G 4: 107,071,006 H113R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddx59 T A 1: 136,416,709 D39E probably benign Het
Defa5 A G 8: 21,297,497 D20G probably damaging Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dlc1 A T 8: 36,937,609 V342E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Dync1h1 A G 12: 110,649,588 I3057V probably benign Het
Etnk2 T G 1: 133,377,053 probably null Het
Fbp2 G T 13: 62,858,207 L31I probably damaging Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gcfc2 A G 6: 81,943,479 E415G probably damaging Het
Glp1r T C 17: 30,925,549 L232P probably damaging Het
Gm10822 A G 2: 73,899,275 noncoding transcript Het
Gm42669 G A 5: 107,507,910 V1192M probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Gpt A G 15: 76,697,976 E211G possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Kcne4 T C 1: 78,817,907 S91P probably benign Het
Kif5b G A 18: 6,213,248 Q715* probably null Het
Lamb1 T A 12: 31,287,429 N386K probably damaging Het
Lcmt2 T C 2: 121,138,616 N662S probably damaging Het
Lnx1 G T 5: 74,620,066 H324N probably benign Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mboat7 T C 7: 3,684,011 probably benign Het
Mlip C T 9: 77,164,863 V341I possibly damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myo3a A T 2: 22,333,677 H442L probably damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nlrp4a T C 7: 26,450,153 L395P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nsun6 A G 2: 15,039,731 probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr1301 A T 2: 111,754,386 M46L probably benign Het
Olfr259 T C 2: 87,108,262 N42D probably damaging Het
Olfr495 A G 7: 108,395,861 H247R probably damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pate4 C A 9: 35,608,257 A46S possibly damaging Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pdk4 A G 6: 5,494,857 probably benign Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Plxdc2 A G 2: 16,713,683 I379M probably damaging Het
Ppp1r35 A G 5: 137,779,894 N217S possibly damaging Het
Prex1 G A 2: 166,569,365 T1438I possibly damaging Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Sacs A T 14: 61,191,919 I476L possibly damaging Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc10a4 G A 5: 73,017,139 probably benign Het
Slc24a2 G T 4: 87,011,646 P538T probably damaging Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
St18 G A 1: 6,827,971 V666M probably benign Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tcp11l1 T C 2: 104,684,139 I428V possibly damaging Het
Th T A 7: 142,895,543 D275V probably damaging Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trdv1 C A 14: 53,882,169 Q96K probably benign Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Ttn C T 2: 76,735,011 G26545R probably damaging Het
Ttn T C 2: 76,757,144 D13208G probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Wrn T A 8: 33,267,825 H812L probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Tubb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Tubb3 APN 8 123420966 missense probably benign 0.20
IGL02208:Tubb3 APN 8 123420864 missense probably damaging 1.00
IGL02253:Tubb3 APN 8 123420820 missense probably benign 0.17
IGL02669:Tubb3 APN 8 123421117 missense probably damaging 0.98
F5770:Tubb3 UTSW 8 123411675 splice site probably benign
PIT4810001:Tubb3 UTSW 8 123421657 missense possibly damaging 0.72
R1164:Tubb3 UTSW 8 123421447 missense probably damaging 1.00
R2074:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2075:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R3012:Tubb3 UTSW 8 123421236 missense probably damaging 1.00
R3913:Tubb3 UTSW 8 123421009 missense possibly damaging 0.94
R3951:Tubb3 UTSW 8 123421264 missense probably damaging 0.99
R4609:Tubb3 UTSW 8 123420919 missense probably damaging 1.00
R5054:Tubb3 UTSW 8 123420868 missense probably damaging 0.99
R5256:Tubb3 UTSW 8 123421652 missense probably benign
R5690:Tubb3 UTSW 8 123421306 missense probably benign 0.14
R7638:Tubb3 UTSW 8 123421161 missense probably benign 0.04
R8263:Tubb3 UTSW 8 123421129 missense possibly damaging 0.90
R8320:Tubb3 UTSW 8 123420855 missense possibly damaging 0.80
Z1088:Tubb3 UTSW 8 123421534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCGGAGCAGTTCACAG -3'
(R):5'- CAGAGCCAAGTGGACTCACATG -3'

Sequencing Primer
(F):5'- GAGCAGTTCACAGCCATGTTC -3'
(R):5'- CACATGGAGTGGGGGTGGC -3'
Posted On2015-06-24